Incidental Mutation 'R6027:Fbxo7'
ID 480117
Institutional Source Beutler Lab
Gene Symbol Fbxo7
Ensembl Gene ENSMUSG00000001786
Gene Name F-box protein 7
Synonyms 2410015K21Rik, A230052G17Rik
MMRRC Submission 044199-MU
Accession Numbers

NCBI RefSeq: NM_153195.2; MGI: 1917004
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6027 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 86021972-86051873 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86048086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 517 (D517G)
Ref Sequence ENSEMBL: ENSMUSP00000120840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001837] [ENSMUST00000117597] [ENSMUST00000120344] [ENSMUST00000130320]
AlphaFold Q3U7U3
Predicted Effect probably benign
Transcript: ENSMUST00000001837
SMART Domains Protein: ENSMUSP00000001837
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Blast:UBQ 1 40 7e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117597
AA Change: D436G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113263
Gene: ENSMUSG00000001786
AA Change: D436G

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 101 245 9.6e-31 PFAM
Pfam:F-box 250 297 2.7e-6 PFAM
Pfam:F-box-like 252 298 7.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120344
AA Change: D438G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113222
Gene: ENSMUSG00000001786
AA Change: D438G

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 103 247 4.8e-31 PFAM
Pfam:F-box 252 299 1.8e-6 PFAM
Pfam:F-box-like 254 300 5.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130320
AA Change: D517G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120840
Gene: ENSMUSG00000001786
AA Change: D517G

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 78 7e-6 SMART
Blast:UBQ 1 79 6e-30 BLAST
Pfam:PI31_Prot_N 188 323 4.7e-20 PFAM
Pfam:F-box 331 378 9.7e-6 PFAM
Pfam:F-box-like 333 379 9.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134490
Meta Mutation Damage Score 0.3723 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype Strain: 4434927
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pro-B cell numbers and increased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Fbxo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Fbxo7 APN 10 86029064 missense probably damaging 0.98
IGL01483:Fbxo7 APN 10 86044581 missense probably damaging 1.00
IGL02502:Fbxo7 APN 10 86033297 missense probably damaging 1.00
IGL02712:Fbxo7 APN 10 86024438 missense possibly damaging 0.75
P0007:Fbxo7 UTSW 10 86033293 missense possibly damaging 0.95
R0410:Fbxo7 UTSW 10 86029238 critical splice donor site probably null
R4119:Fbxo7 UTSW 10 86021895 unclassified probably benign
R4604:Fbxo7 UTSW 10 86046802 missense probably damaging 1.00
R4884:Fbxo7 UTSW 10 86029150 missense probably damaging 0.99
R5088:Fbxo7 UTSW 10 86021920 unclassified probably benign
R5286:Fbxo7 UTSW 10 86022090 missense probably damaging 1.00
R5387:Fbxo7 UTSW 10 86024654 missense probably benign 0.01
R5451:Fbxo7 UTSW 10 86029037 missense probably benign 0.01
R5491:Fbxo7 UTSW 10 86048026 missense probably damaging 1.00
R5542:Fbxo7 UTSW 10 86033285 missense probably benign 0.00
R5647:Fbxo7 UTSW 10 86029110 missense probably damaging 0.98
R6152:Fbxo7 UTSW 10 86024696 missense probably benign 0.01
R6280:Fbxo7 UTSW 10 86029105 missense probably benign 0.00
R6615:Fbxo7 UTSW 10 86044534 missense possibly damaging 0.48
R7405:Fbxo7 UTSW 10 86044581 missense probably damaging 1.00
R8785:Fbxo7 UTSW 10 86024546 missense probably benign 0.02
R9743:Fbxo7 UTSW 10 86047909 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATATGATGAGAGGCCGATACTG -3'
(R):5'- CACAATCTCCATCCCAGAGGTG -3'

Sequencing Primer
(F):5'- ATACTGCCTAGTGTTGGGGACC -3'
(R):5'- CATCCCAGAGGTGAACCAGAG -3'
Posted On 2017-06-26