Incidental Mutation 'R6027:Gnptab'
ID480118
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88433225 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 597 (T597A)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: T597A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: T597A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
R7463:Gnptab UTSW 10 88431389 missense probably damaging 1.00
R7596:Gnptab UTSW 10 88443370 missense probably damaging 0.99
R7654:Gnptab UTSW 10 88445819 missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88379528 missense probably damaging 0.99
R7770:Gnptab UTSW 10 88411920 missense probably benign 0.41
R7791:Gnptab UTSW 10 88440222 critical splice acceptor site probably null
R7838:Gnptab UTSW 10 88440392 critical splice donor site probably null
R7921:Gnptab UTSW 10 88440392 critical splice donor site probably null
R8002:Gnptab UTSW 10 88440268 missense probably benign 0.14
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Z1176:Gnptab UTSW 10 88431368 missense probably damaging 1.00
Z1177:Gnptab UTSW 10 88440270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCCAGAGAATTAAGGCC -3'
(R):5'- ACCAAACTTTCATAGGCCTTCTG -3'

Sequencing Primer
(F):5'- GCCTAATTAAAAGGAAACCATGTTTG -3'
(R):5'- CAAACTTTCATAGGCCTTCTGGGTTG -3'
Posted On2017-06-26