Incidental Mutation 'R6027:Bptf'
ID480124
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Namebromodomain PHD finger transcription factor
Synonyms9430093H17Rik, Falz
MMRRC Submission 044199-MU
Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107033081-107132127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107074945 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1141 (E1141G)
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
Predicted Effect probably damaging
Transcript: ENSMUST00000057892
AA Change: E1026G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: E1026G

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106762
AA Change: E1078G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: E1078G

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: E1141G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: E1141G

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Meta Mutation Damage Score 0.1177 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 107055279 missense possibly damaging 0.88
IGL00664:Bptf APN 11 107077665 missense possibly damaging 0.78
IGL00705:Bptf APN 11 107095708 splice site probably benign
IGL00796:Bptf APN 11 107054550 missense probably damaging 1.00
IGL00834:Bptf APN 11 107073928 missense possibly damaging 0.59
IGL01155:Bptf APN 11 107080727 missense probably damaging 1.00
IGL01314:Bptf APN 11 107054853 missense probably damaging 1.00
IGL01371:Bptf APN 11 107055907 missense probably benign 0.00
IGL01567:Bptf APN 11 107058774 missense probably damaging 1.00
IGL01794:Bptf APN 11 107053221 critical splice donor site probably null
IGL02108:Bptf APN 11 107074988 missense probably benign 0.45
IGL02367:Bptf APN 11 107073352 missense probably benign
IGL02437:Bptf APN 11 107074695 missense probably benign 0.00
IGL02589:Bptf APN 11 107111531 missense possibly damaging 0.92
IGL02897:Bptf APN 11 107047121 missense probably damaging 1.00
IGL02935:Bptf APN 11 107080799 missense probably damaging 1.00
IGL02954:Bptf APN 11 107054749 missense possibly damaging 0.89
IGL02982:Bptf APN 11 107076674 missense probably damaging 1.00
IGL03109:Bptf APN 11 107061701 missense possibly damaging 0.53
IGL03265:Bptf APN 11 107054628 missense probably benign 0.00
IGL03403:Bptf APN 11 107099733 missense possibly damaging 0.51
IGL03097:Bptf UTSW 11 107077680 missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 107054788 missense probably damaging 0.98
R0066:Bptf UTSW 11 107062136 missense possibly damaging 0.90
R0157:Bptf UTSW 11 107074658 missense possibly damaging 0.89
R0320:Bptf UTSW 11 107072819 missense probably damaging 1.00
R0328:Bptf UTSW 11 107047127 missense probably damaging 1.00
R0402:Bptf UTSW 11 107074114 missense probably damaging 1.00
R0482:Bptf UTSW 11 107081262 missense probably benign 0.13
R0574:Bptf UTSW 11 107076527 missense probably damaging 1.00
R0598:Bptf UTSW 11 107072965 missense probably damaging 0.99
R0599:Bptf UTSW 11 107068382 missense probably damaging 1.00
R0601:Bptf UTSW 11 107061692 missense probably benign 0.04
R0744:Bptf UTSW 11 107110812 critical splice donor site probably null
R0836:Bptf UTSW 11 107110812 critical splice donor site probably null
R0885:Bptf UTSW 11 107043791 missense probably damaging 1.00
R1070:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1252:Bptf UTSW 11 107073251 missense probably benign 0.00
R1370:Bptf UTSW 11 107047094 missense probably damaging 0.99
R1428:Bptf UTSW 11 107073047 missense probably damaging 0.99
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1742:Bptf UTSW 11 107110951 missense probably damaging 1.00
R1816:Bptf UTSW 11 107060579 missense probably damaging 1.00
R1858:Bptf UTSW 11 107073301 missense probably benign 0.00
R1989:Bptf UTSW 11 107074826 missense probably damaging 1.00
R2253:Bptf UTSW 11 107111322 missense probably damaging 1.00
R2392:Bptf UTSW 11 107072747 missense probably damaging 1.00
R2431:Bptf UTSW 11 107047240 missense possibly damaging 0.48
R3022:Bptf UTSW 11 107111637 critical splice acceptor site probably null
R3161:Bptf UTSW 11 107074476 missense probably damaging 1.00
R3686:Bptf UTSW 11 107074198 missense probably benign 0.25
R3687:Bptf UTSW 11 107074198 missense probably benign 0.25
R3688:Bptf UTSW 11 107074198 missense probably benign 0.25
R3787:Bptf UTSW 11 107073827 missense probably damaging 1.00
R3834:Bptf UTSW 11 107073857 missense probably benign 0.05
R3885:Bptf UTSW 11 107074513 missense probably damaging 0.97
R4090:Bptf UTSW 11 107081523 missense probably damaging 0.99
R4398:Bptf UTSW 11 107110844 missense probably damaging 1.00
R4437:Bptf UTSW 11 107074474 missense possibly damaging 0.59
R4514:Bptf UTSW 11 107077692 missense probably damaging 1.00
R4565:Bptf UTSW 11 107073010 missense probably damaging 1.00
R4715:Bptf UTSW 11 107047181 missense probably damaging 1.00
R4748:Bptf UTSW 11 107095880 missense probably damaging 0.96
R4764:Bptf UTSW 11 107043694 missense probably damaging 1.00
R4885:Bptf UTSW 11 107074648 missense probably benign 0.39
R4901:Bptf UTSW 11 107110860 nonsense probably null
R4995:Bptf UTSW 11 107054565 missense probably damaging 0.98
R5057:Bptf UTSW 11 107082528 missense probably damaging 0.98
R5120:Bptf UTSW 11 107073385 missense probably damaging 0.99
R5320:Bptf UTSW 11 107081367 nonsense probably null
R5329:Bptf UTSW 11 107073295 missense probably benign 0.06
R5418:Bptf UTSW 11 107111294 missense probably damaging 1.00
R5461:Bptf UTSW 11 107061764 missense probably damaging 1.00
R5664:Bptf UTSW 11 107073699 missense probably benign 0.01
R5718:Bptf UTSW 11 107111434 missense probably damaging 1.00
R5774:Bptf UTSW 11 107111137 missense probably damaging 1.00
R5851:Bptf UTSW 11 107110862 missense probably damaging 1.00
R5930:Bptf UTSW 11 107073196 missense probably damaging 1.00
R5949:Bptf UTSW 11 107111089 missense probably damaging 0.99
R5975:Bptf UTSW 11 107035864 utr 3 prime probably benign
R6128:Bptf UTSW 11 107074690 missense possibly damaging 0.87
R6337:Bptf UTSW 11 107058779 missense possibly damaging 0.89
R6407:Bptf UTSW 11 107111126 missense probably damaging 1.00
R6470:Bptf UTSW 11 107072767 missense probably damaging 1.00
R6487:Bptf UTSW 11 107077726 missense probably damaging 0.99
R6501:Bptf UTSW 11 107077683 missense probably null 1.00
R6755:Bptf UTSW 11 107047256 missense probably benign 0.27
R6861:Bptf UTSW 11 107062565 missense probably damaging 1.00
R6866:Bptf UTSW 11 107073580 missense probably damaging 1.00
R6879:Bptf UTSW 11 107042690 missense probably benign 0.32
R6927:Bptf UTSW 11 107054595 missense probably damaging 1.00
R6944:Bptf UTSW 11 107080823 missense probably damaging 1.00
R7082:Bptf UTSW 11 107086747 missense probably benign 0.00
R7136:Bptf UTSW 11 107099715 missense probably damaging 1.00
R7162:Bptf UTSW 11 107043631 critical splice donor site probably null
R7171:Bptf UTSW 11 107131407 missense unknown
R7193:Bptf UTSW 11 107054809 nonsense probably null
R7210:Bptf UTSW 11 107054464 nonsense probably null
R7221:Bptf UTSW 11 107054832 missense probably damaging 1.00
R7316:Bptf UTSW 11 107073109 missense probably damaging 1.00
R7316:Bptf UTSW 11 107110914 nonsense probably null
R7422:Bptf UTSW 11 107060558 missense probably damaging 1.00
R7454:Bptf UTSW 11 107044640 missense probably benign 0.03
R7657:Bptf UTSW 11 107074729 missense probably damaging 1.00
R7718:Bptf UTSW 11 107081456 missense possibly damaging 0.65
R7827:Bptf UTSW 11 107047187 missense probably benign 0.01
R7844:Bptf UTSW 11 107074061 missense probably damaging 0.97
R7992:Bptf UTSW 11 107110883 missense probably benign 0.00
R8001:Bptf UTSW 11 107047340 nonsense probably null
R8037:Bptf UTSW 11 107055950 missense probably damaging 1.00
R8122:Bptf UTSW 11 107036591 critical splice acceptor site probably null
R8235:Bptf UTSW 11 107076632 missense probably benign 0.04
R8308:Bptf UTSW 11 107052989 missense probably damaging 0.99
Z1088:Bptf UTSW 11 107074582 missense probably benign 0.00
Z1176:Bptf UTSW 11 107058684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAATCCTCCGTTCCAGAAG -3'
(R):5'- GCACCAAATCTCAGAGTCTTCTAG -3'

Sequencing Primer
(F):5'- TTCCAGAAGCCCGTCCAG -3'
(R):5'- GCCCCATTTAAAGTTTAGCAGTGTC -3'
Posted On2017-06-26