Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Scin'

480126

Institutional Source

Beutler Lab

Gene Symbol

Scin

Ensembl Gene

ENSMUSG00000002565

Gene Name

scinderin

Synonyms

adseverin

MMRRC Submission

044199-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40059769-40134228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40077516 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 425 (Y425C)

Ref Sequence

ENSEMBL: ENSMUSP00000077573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002640
AA Change: Y425C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: Y425C

Domain	Start	End	E-Value	Type
GEL	17	114	3.44e-26	SMART
GEL	135	227	3.92e-30	SMART
low complexity region	232	242	N/A	INTRINSIC
GEL	252	347	6.56e-32	SMART
GEL	396	489	7.72e-29	SMART
GEL	510	596	2.33e-23	SMART
GEL	615	710	2.07e-29	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000078481
AA Change: Y425C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565
AA Change: Y425C

Domain	Start	End	E-Value	Type
GEL	17	114	3.44e-26	SMART
GEL	135	227	3.92e-30	SMART
low complexity region	232	242	N/A	INTRINSIC
GEL	252	347	6.56e-32	SMART
GEL	396	489	7.72e-29	SMART
GEL	510	610	1.09e-28	SMART

Meta Mutation Damage Score

0.8938

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Scin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Scin	APN	12	40076972	missense	probably benign	0.03
IGL01414:Scin	APN	12	40124699	missense	probably damaging	1.00
IGL01790:Scin	APN	12	40063257	missense	probably benign	0.02
IGL01807:Scin	APN	12	40084289	missense	probably damaging	1.00
IGL01946:Scin	APN	12	40060491	utr 3 prime	probably benign
IGL02040:Scin	APN	12	40069453	intron	probably benign
IGL02391:Scin	APN	12	40077531	missense	probably benign	0.05
IGL03221:Scin	APN	12	40076974	missense	probably benign	0.01
I1329:Scin	UTSW	12	40073330	missense	probably damaging	0.99
PIT4498001:Scin	UTSW	12	40069447	critical splice acceptor site	probably null
R0108:Scin	UTSW	12	40127987	missense	possibly damaging	0.68
R0470:Scin	UTSW	12	40073292	splice site	probably benign
R0477:Scin	UTSW	12	40060516	missense	probably damaging	1.00
R0538:Scin	UTSW	12	40081771	missense	probably damaging	0.98
R0539:Scin	UTSW	12	40081766	missense	possibly damaging	0.65
R0591:Scin	UTSW	12	40080930	critical splice donor site	probably null
R0668:Scin	UTSW	12	40080949	missense	probably damaging	1.00
R0718:Scin	UTSW	12	40079607	missense	probably damaging	1.00
R1473:Scin	UTSW	12	40077502	missense	probably benign
R1566:Scin	UTSW	12	40081674	missense	probably benign	0.17
R1570:Scin	UTSW	12	40084381	splice site	probably benign
R1624:Scin	UTSW	12	40127930	missense	probably benign
R1827:Scin	UTSW	12	40068923	missense	possibly damaging	0.88
R1836:Scin	UTSW	12	40124698	missense	probably damaging	1.00
R1985:Scin	UTSW	12	40133908	critical splice donor site	probably null
R2042:Scin	UTSW	12	40077510	missense	possibly damaging	0.96
R2061:Scin	UTSW	12	40080948	missense	probably damaging	1.00
R2147:Scin	UTSW	12	40080985	missense	probably benign	0.00
R2232:Scin	UTSW	12	40068931	missense	probably damaging	1.00
R2504:Scin	UTSW	12	40081706	missense	probably benign	0.02
R4781:Scin	UTSW	12	40081764	missense	possibly damaging	0.59
R4898:Scin	UTSW	12	40104932	missense	probably benign
R4914:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4915:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4916:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4917:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4918:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R5068:Scin	UTSW	12	40124700	missense	probably damaging	1.00
R5098:Scin	UTSW	12	40077542	nonsense	probably null
R5233:Scin	UTSW	12	40077559	missense	probably benign
R5564:Scin	UTSW	12	40124569	missense	probably benign
R5677:Scin	UTSW	12	40063259	missense	probably damaging	1.00
R5967:Scin	UTSW	12	40077538	missense	probably benign	0.35
R6130:Scin	UTSW	12	40069436	missense	probably benign	0.01
R6134:Scin	UTSW	12	40060579	missense	probably damaging	1.00
R6135:Scin	UTSW	12	40079808	missense	possibly damaging	0.80
R6439:Scin	UTSW	12	40068946	missense	probably damaging	0.99
R6613:Scin	UTSW	12	40079715	missense	probably benign	0.04
R7127:Scin	UTSW	12	40105072	missense	possibly damaging	0.69
R7234:Scin	UTSW	12	40080958	nonsense	probably null
R7431:Scin	UTSW	12	40133922	missense	probably damaging	1.00
R7609:Scin	UTSW	12	40124589	missense	probably damaging	1.00
R7665:Scin	UTSW	12	40069415	missense	probably damaging	1.00
R7704:Scin	UTSW	12	40124688	missense	possibly damaging	0.93
R7904:Scin	UTSW	12	40077000	missense	probably damaging	1.00
R7995:Scin	UTSW	12	40079805	missense	probably benign	0.00
R8323:Scin	UTSW	12	40079682	missense	probably benign	0.00
R8489:Scin	UTSW	12	40081020	missense	probably damaging	1.00
R8556:Scin	UTSW	12	40077594	critical splice acceptor site	probably null
X0018:Scin	UTSW	12	40069433	missense	probably damaging	1.00
Z1176:Scin	UTSW	12	40079604	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- ACAGTGCACAGAATCTGAGTAC -3'
(R):5'- CTCAGAACTGATGAGATATTGTGGAG -3'

Sequencing Primer
(F):5'- GAGTACTATCTGCACGCTGTACAG -3'
(R):5'- GTCAAGAAATTTGTTAACCTTCTTGC -3'

Posted On

2017-06-26