Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Adamts6'

480129

Institutional Source

Beutler Lab

Gene Symbol

Adamts6

Ensembl Gene

ENSMUSG00000046169

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6

Synonyms

b2b2187.1Clo, b2b2182Clo, ADAM-TS6, b2b2029Clo, b2b1879.1Clo, b2b2228Clo, A930019D11Rik

MMRRC Submission

044199-MU

Accession Numbers

NCBI RefSeq: NM_001081020.1; MGI: 1347348

Is this an essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104287835-104496695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 104479535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1035 (G1035D)

Ref Sequence

ENSEMBL: ENSMUSP00000153359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224742] [ENSMUST00000224784]

AlphaFold

D3Z1A5

Predicted Effect

probably damaging
Transcript: ENSMUST00000065766
AA Change: G1035D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: G1035D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	191	4.2e-40	PFAM
Pfam:Reprolysin_5	248	443	3.8e-17	PFAM
Pfam:Reprolysin_4	248	464	4.9e-12	PFAM
Pfam:Reprolysin	250	468	1.6e-27	PFAM
Pfam:Reprolysin_2	268	458	5.6e-15	PFAM
Pfam:Reprolysin_3	272	414	2.6e-14	PFAM
TSP1	561	613	3.98e-13	SMART
Pfam:ADAM_spacer1	717	829	2.9e-41	PFAM
TSP1	843	900	2.49e-5	SMART
TSP1	902	960	2.87e-5	SMART
TSP1	963	1018	1.36e-1	SMART
TSP1	1021	1069	2.36e-6	SMART
Pfam:PLAC	1083	1115	3.9e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000224208
AA Change: G1035D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000224303

Predicted Effect

probably benign
Transcript: ENSMUST00000224742

Predicted Effect

probably benign
Transcript: ENSMUST00000224784

Meta Mutation Damage Score

0.3232

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Adamts6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Adamts6	APN	13	104429790	missense	possibly damaging	0.79
IGL00583:Adamts6	APN	13	104297218	nonsense	probably null
IGL01305:Adamts6	APN	13	104390082	missense	probably damaging	1.00
IGL01448:Adamts6	APN	13	104297164	missense	probably damaging	1.00
IGL01517:Adamts6	APN	13	104390192	splice site	probably benign
IGL01678:Adamts6	APN	13	104313688	missense	probably damaging	1.00
IGL01737:Adamts6	APN	13	104390135	missense	probably damaging	0.99
IGL02152:Adamts6	APN	13	104313660	missense	probably null	1.00
IGL02217:Adamts6	APN	13	104462365	splice site	probably benign
IGL02828:Adamts6	APN	13	104297470	missense	probably damaging	1.00
IGL03067:Adamts6	APN	13	104297275	missense	probably damaging	1.00
IGL03081:Adamts6	APN	13	104444956	utr 3 prime	probably benign
IGL03159:Adamts6	APN	13	104444215	missense	probably damaging	1.00
IGL03411:Adamts6	APN	13	104314334	missense	possibly damaging	0.77
De_vito	UTSW	13	104347392	critical splice donor site	probably null
festinator	UTSW	13	104479535	missense	probably damaging	1.00
ANU22:Adamts6	UTSW	13	104390082	missense	probably damaging	1.00
P0007:Adamts6	UTSW	13	104297491	missense	possibly damaging	0.73
R0362:Adamts6	UTSW	13	104390076	critical splice acceptor site	probably null
R0504:Adamts6	UTSW	13	104426930	splice site	probably benign
R0549:Adamts6	UTSW	13	104297255	missense	possibly damaging	0.60
R0566:Adamts6	UTSW	13	104444927	missense	probably benign	0.00
R0703:Adamts6	UTSW	13	104352847	missense	probably damaging	1.00
R0799:Adamts6	UTSW	13	104314271	missense	probably damaging	1.00
R0838:Adamts6	UTSW	13	104413789	missense	possibly damaging	0.47
R1500:Adamts6	UTSW	13	104312881	missense	probably damaging	1.00
R1502:Adamts6	UTSW	13	104493637	missense	probably damaging	1.00
R1547:Adamts6	UTSW	13	104444875	missense	probably benign	0.26
R1619:Adamts6	UTSW	13	104312777	missense	probably benign	0.14
R1727:Adamts6	UTSW	13	104428964	splice site	probably benign
R1967:Adamts6	UTSW	13	104426951	nonsense	probably null
R2013:Adamts6	UTSW	13	104314304	missense	probably damaging	0.98
R2079:Adamts6	UTSW	13	104462238	missense	probably benign	0.00
R2432:Adamts6	UTSW	13	104426977	missense	probably benign	0.01
R3118:Adamts6	UTSW	13	104314279	missense	possibly damaging	0.91
R4125:Adamts6	UTSW	13	104312904	missense	probably damaging	1.00
R4274:Adamts6	UTSW	13	104314279	missense	possibly damaging	0.91
R4795:Adamts6	UTSW	13	104444128	nonsense	probably null
R4841:Adamts6	UTSW	13	104312787	missense	probably benign	0.00
R4976:Adamts6	UTSW	13	104297490	missense	probably damaging	0.98
R5085:Adamts6	UTSW	13	104307243	missense	probably damaging	0.99
R5234:Adamts6	UTSW	13	104493622	missense	probably damaging	1.00
R5403:Adamts6	UTSW	13	104352815	missense	possibly damaging	0.86
R5753:Adamts6	UTSW	13	104347350	missense	probably damaging	1.00
R6187:Adamts6	UTSW	13	104297425	missense	probably damaging	1.00
R6229:Adamts6	UTSW	13	104347392	critical splice donor site	probably null
R6243:Adamts6	UTSW	13	104314301	missense	probably damaging	0.99
R6257:Adamts6	UTSW	13	104462282	missense	probably benign
R6743:Adamts6	UTSW	13	104428928	missense	probably damaging	1.00
R6775:Adamts6	UTSW	13	104313652	missense	probably damaging	0.97
R7113:Adamts6	UTSW	13	104312759	missense	probably benign
R7351:Adamts6	UTSW	13	104390112	missense	possibly damaging	0.63
R7520:Adamts6	UTSW	13	104297186	missense	probably benign	0.01
R7866:Adamts6	UTSW	13	104413749	nonsense	probably null
R8274:Adamts6	UTSW	13	104313673	missense	probably benign	0.02
R8348:Adamts6	UTSW	13	104479519	missense	probably damaging	0.99
R8448:Adamts6	UTSW	13	104479519	missense	probably damaging	0.99
R8686:Adamts6	UTSW	13	104313699	missense	probably damaging	1.00
R8691:Adamts6	UTSW	13	104314331	missense	probably benign	0.00
R8962:Adamts6	UTSW	13	104297391	missense	probably damaging	0.99
R8978:Adamts6	UTSW	13	104375739	missense	probably damaging	1.00
R9075:Adamts6	UTSW	13	104462285	missense	probably benign
R9080:Adamts6	UTSW	13	104312919	missense	probably damaging	1.00
R9152:Adamts6	UTSW	13	104476767	missense	probably benign	0.06
R9213:Adamts6	UTSW	13	104444932	missense	probably damaging	1.00
X0065:Adamts6	UTSW	13	104493628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGAGTACTCACTATATGGCCTTTG -3'
(R):5'- GTCACATAATCAAGCTCTTTGGG -3'

Sequencing Primer
(F):5'- CTTGAGTTTTGAAACCAATTCCATAG -3'
(R):5'- GGTACTCACCTTCAGTACTGGAGAG -3'

Posted On

2017-06-26