Incidental Mutation 'R6027:Ripk4'
ID480136
Institutional Source Beutler Lab
Gene Symbol Ripk4
Ensembl Gene ENSMUSG00000005251
Gene Namereceptor-interacting serine-threonine kinase 4
SynonymsAnkrd3, DIk, PKK, ANKK2, RIP4
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location97741933-97763787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97744074 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 458 (W458R)
Ref Sequence ENSEMBL: ENSMUSP00000019386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019386] [ENSMUST00000113743]
Predicted Effect probably damaging
Transcript: ENSMUST00000019386
AA Change: W458R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: W458R

DomainStartEndE-ValueType
Pfam:Pkinase 22 283 1.8e-47 PFAM
Pfam:Pkinase_Tyr 23 283 6e-45 PFAM
low complexity region 356 396 N/A INTRINSIC
ANK 439 468 2.58e-3 SMART
ANK 472 501 3.41e-3 SMART
ANK 505 534 7.42e-4 SMART
ANK 538 567 3.57e-6 SMART
ANK 571 601 3.85e-2 SMART
ANK 605 634 3.15e-7 SMART
ANK 638 667 5.16e-3 SMART
ANK 671 700 2.2e-6 SMART
ANK 704 734 1.68e-2 SMART
ANK 736 765 3.46e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113743
AA Change: W395R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109372
Gene: ENSMUSG00000005251
AA Change: W395R

DomainStartEndE-ValueType
Pfam:Pkinase 1 220 1e-39 PFAM
Pfam:Pkinase_Tyr 1 220 7.4e-39 PFAM
low complexity region 293 333 N/A INTRINSIC
ANK 376 405 2.58e-3 SMART
ANK 409 438 3.41e-3 SMART
ANK 442 471 7.42e-4 SMART
ANK 475 504 3.57e-6 SMART
ANK 508 538 3.85e-2 SMART
ANK 542 571 3.15e-7 SMART
ANK 575 604 5.16e-3 SMART
ANK 608 637 2.2e-6 SMART
ANK 641 671 1.68e-2 SMART
ANK 673 702 3.46e-4 SMART
Meta Mutation Damage Score 0.3895 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Ripk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ripk4 APN 16 97751496 nonsense probably null
IGL01823:Ripk4 APN 16 97755283 missense possibly damaging 0.89
IGL01921:Ripk4 APN 16 97743365 missense possibly damaging 0.62
IGL02023:Ripk4 APN 16 97755231 missense probably damaging 1.00
IGL02201:Ripk4 APN 16 97755177 missense possibly damaging 0.91
IGL02709:Ripk4 APN 16 97743566 missense probably damaging 1.00
I2288:Ripk4 UTSW 16 97748145 missense probably benign 0.16
PIT4495001:Ripk4 UTSW 16 97743170 missense probably damaging 0.99
R0060:Ripk4 UTSW 16 97763518 splice site probably benign
R0112:Ripk4 UTSW 16 97743561 missense probably benign 0.00
R0383:Ripk4 UTSW 16 97748112 missense probably damaging 1.00
R0524:Ripk4 UTSW 16 97755287 nonsense probably null
R0540:Ripk4 UTSW 16 97744175 missense probably damaging 1.00
R0967:Ripk4 UTSW 16 97744172 missense probably damaging 1.00
R1646:Ripk4 UTSW 16 97743897 missense probably damaging 1.00
R1785:Ripk4 UTSW 16 97750131 missense probably damaging 1.00
R2058:Ripk4 UTSW 16 97744142 nonsense probably null
R2134:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R2135:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R3410:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R3411:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R4538:Ripk4 UTSW 16 97743152 nonsense probably null
R4627:Ripk4 UTSW 16 97744026 missense probably damaging 0.99
R4665:Ripk4 UTSW 16 97755073 missense probably damaging 0.98
R4704:Ripk4 UTSW 16 97746004 nonsense probably null
R4769:Ripk4 UTSW 16 97744062 missense probably damaging 1.00
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R5240:Ripk4 UTSW 16 97743767 missense probably damaging 1.00
R5864:Ripk4 UTSW 16 97763582 missense probably damaging 0.98
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6291:Ripk4 UTSW 16 97755123 missense probably damaging 1.00
R6343:Ripk4 UTSW 16 97763526 critical splice donor site probably benign
R6572:Ripk4 UTSW 16 97745905 nonsense probably null
R6783:Ripk4 UTSW 16 97748037 missense probably damaging 1.00
R6822:Ripk4 UTSW 16 97746036 missense probably damaging 1.00
R7215:Ripk4 UTSW 16 97747323 splice site probably null
R7251:Ripk4 UTSW 16 97743249 missense probably benign
R7275:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R7356:Ripk4 UTSW 16 97743149 missense probably damaging 0.98
R7621:Ripk4 UTSW 16 97745925 missense probably damaging 1.00
R8065:Ripk4 UTSW 16 97763537 missense probably damaging 0.97
R8067:Ripk4 UTSW 16 97763537 missense probably damaging 0.97
R8191:Ripk4 UTSW 16 97763526 critical splice donor site probably benign
Z1176:Ripk4 UTSW 16 97750102 missense probably damaging 1.00
Z1177:Ripk4 UTSW 16 97755178 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTCTGGGCTGCAAAGTGC -3'
(R):5'- CACATTCTATAGTGGTTGCCCC -3'

Sequencing Primer
(F):5'- CAAAGTGCAGGGCAGTCCAC -3'
(R):5'- TCTCCCTGCAGACCTGG -3'
Posted On2017-06-26