Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Ythdc2'

480139

Institutional Source

Beutler Lab

Gene Symbol

Ythdc2

Ensembl Gene

ENSMUSG00000034653

Gene Name

YTH domain containing 2

Synonyms

3010002F02Rik

MMRRC Submission

044199-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44827746-44889724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44860436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 194 (D194E)

Ref Sequence

ENSEMBL: ENSMUSP00000144479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037763] [ENSMUST00000201507]

AlphaFold

B2RR83

Predicted Effect

probably benign
Transcript: ENSMUST00000037763
AA Change: D849E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: D849E

Domain	Start	End	E-Value	Type
low complexity region	2	50	N/A	INTRINSIC
Pfam:R3H	59	119	1.7e-15	PFAM
DEXDc	206	393	4.95e-26	SMART
low complexity region	413	428	N/A	INTRINSIC
ANK	521	550	2.79e1	SMART
ANK	554	583	1.5e2	SMART
HELICc	648	759	5.31e-17	SMART
HA2	823	916	2.58e-22	SMART
Pfam:OB_NTP_bind	953	1082	1.3e-18	PFAM
low complexity region	1263	1299	N/A	INTRINSIC
Pfam:YTH	1303	1434	7.2e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201507
AA Change: D194E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000144479
Gene: ENSMUSG00000034653
AA Change: D194E

Domain	Start	End	E-Value	Type
HELICc	5	104	9.1e-19	SMART
HA2	168	261	2e-26	SMART
Pfam:OB_NTP_bind	298	427	6e-16	PFAM
low complexity region	570	582	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202176

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het

Other mutations in Ythdc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ythdc2	APN	18	44859973	missense	probably benign
IGL00341:Ythdc2	APN	18	44850397	missense	probably benign	0.00
IGL00502:Ythdc2	APN	18	44847812	missense	probably damaging	0.99
IGL00585:Ythdc2	APN	18	44864361	missense	probably damaging	1.00
IGL01081:Ythdc2	APN	18	44850659	missense	probably benign	0.19
IGL01569:Ythdc2	APN	18	44887651	missense	probably benign
IGL01577:Ythdc2	APN	18	44858282	missense	probably benign	0.00
IGL01617:Ythdc2	APN	18	44841415	missense	possibly damaging	0.53
IGL01674:Ythdc2	APN	18	44860404	missense	probably benign	0.04
IGL01736:Ythdc2	APN	18	44850668	missense	probably damaging	0.97
IGL02095:Ythdc2	APN	18	44873140	splice site	probably benign
IGL02245:Ythdc2	APN	18	44862684	missense	possibly damaging	0.74
IGL02524:Ythdc2	APN	18	44847854	missense	probably damaging	0.98
IGL02542:Ythdc2	APN	18	44840241	missense	probably damaging	1.00
IGL02622:Ythdc2	APN	18	44859934	missense	probably damaging	0.99
IGL02795:Ythdc2	APN	18	44837438	missense	possibly damaging	0.95
IGL02935:Ythdc2	APN	18	44855045	missense	probably damaging	1.00
PIT4618001:Ythdc2	UTSW	18	44834598	missense	probably benign	0.19
R0115:Ythdc2	UTSW	18	44841423	splice site	probably benign
R0329:Ythdc2	UTSW	18	44865060	splice site	probably benign
R0472:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R0530:Ythdc2	UTSW	18	44850398	missense	probably damaging	0.99
R0547:Ythdc2	UTSW	18	44840264	missense	possibly damaging	0.92
R0563:Ythdc2	UTSW	18	44864848	splice site	probably benign
R0609:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R1291:Ythdc2	UTSW	18	44855209	missense	probably benign	0.33
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1724:Ythdc2	UTSW	18	44828690	missense	probably benign	0.04
R1860:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R2040:Ythdc2	UTSW	18	44855174	nonsense	probably null
R2308:Ythdc2	UTSW	18	44847748	missense	possibly damaging	0.95
R3711:Ythdc2	UTSW	18	44833173	missense	probably damaging	0.98
R4005:Ythdc2	UTSW	18	44833128	missense	probably benign	0.00
R4580:Ythdc2	UTSW	18	44858198	missense	possibly damaging	0.81
R4631:Ythdc2	UTSW	18	44887631	missense	probably benign	0.03
R4815:Ythdc2	UTSW	18	44885240	missense	probably benign	0.40
R4924:Ythdc2	UTSW	18	44847804	missense	probably damaging	1.00
R4982:Ythdc2	UTSW	18	44871465	missense	probably benign	0.01
R5011:Ythdc2	UTSW	18	44854742	missense	probably benign	0.38
R5141:Ythdc2	UTSW	18	44865047	missense	probably benign	0.01
R5147:Ythdc2	UTSW	18	44844292	missense	probably damaging	0.98
R5280:Ythdc2	UTSW	18	44860621	missense	probably damaging	1.00
R5388:Ythdc2	UTSW	18	44857025	missense	possibly damaging	0.65
R5928:Ythdc2	UTSW	18	44833205	missense	probably benign
R5931:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R5995:Ythdc2	UTSW	18	44886253	missense	probably damaging	1.00
R6056:Ythdc2	UTSW	18	44840210	missense	probably damaging	0.98
R6318:Ythdc2	UTSW	18	44860377	missense	probably benign	0.04
R6399:Ythdc2	UTSW	18	44886402	missense	possibly damaging	0.93
R6586:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R6684:Ythdc2	UTSW	18	44873069	missense	possibly damaging	0.47
R7040:Ythdc2	UTSW	18	44834462	missense	probably benign	0.02
R7071:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R7105:Ythdc2	UTSW	18	44834563	missense	probably damaging	1.00
R7148:Ythdc2	UTSW	18	44833122	missense	probably benign	0.42
R7290:Ythdc2	UTSW	18	44837491	missense	possibly damaging	0.50
R7806:Ythdc2	UTSW	18	44844286	missense	possibly damaging	0.91
R7806:Ythdc2	UTSW	18	44850424	missense	probably benign	0.05
R8114:Ythdc2	UTSW	18	44877740	missense	probably benign	0.15
R8820:Ythdc2	UTSW	18	44834464	nonsense	probably null
R8840:Ythdc2	UTSW	18	44860624	missense	probably damaging	1.00
R8998:Ythdc2	UTSW	18	44864304	missense	probably benign	0.31
R9065:Ythdc2	UTSW	18	44844351	missense	probably benign	0.00
R9196:Ythdc2	UTSW	18	44855397	missense	probably damaging	0.96
R9251:Ythdc2	UTSW	18	44841375	missense	probably benign	0.00
R9331:Ythdc2	UTSW	18	44837432	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGCTGTGCAGATGCTTAAGG -3'
(R):5'- AGTGAAGCGTTTCCTACAAAGC -3'

Sequencing Primer
(F):5'- CAGATGCTTAAGGTTGGTGCTTCC -3'
(R):5'- GCGTTTCCTACAAAGCATAGCTG -3'

Posted On

2017-06-26