Incidental Mutation 'R6028:Ncl'
ID480144
Institutional Source Beutler Lab
Gene Symbol Ncl
Ensembl Gene ENSMUSG00000026234
Gene Namenucleolin
SynonymsB530004O11Rik, C23
MMRRC Submission 044200-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location86344719-86359400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86356133 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 322 (V322A)
Ref Sequence ENSEMBL: ENSMUSP00000027438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027438] [ENSMUST00000185785]
Predicted Effect probably benign
Transcript: ENSMUST00000027438
AA Change: V322A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027438
Gene: ENSMUSG00000026234
AA Change: V322A

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 121 142 N/A INTRINSIC
low complexity region 143 168 N/A INTRINSIC
low complexity region 178 188 N/A INTRINSIC
low complexity region 189 215 N/A INTRINSIC
low complexity region 241 273 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
RRM 310 381 2.1e-8 SMART
RRM 396 464 1.97e-13 SMART
RRM 488 557 4.56e-18 SMART
RRM 570 640 1.04e-21 SMART
low complexity region 648 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185676
Predicted Effect probably benign
Transcript: ENSMUST00000185785
SMART Domains Protein: ENSMUSP00000140696
Gene: ENSMUSG00000026234

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
low complexity region 35 50 N/A INTRINSIC
low complexity region 53 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197651
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleolin (NCL), a eukaryotic nucleolar phosphoprotein, is involved in the synthesis and maturation of ribosomes. It is located mainly in dense fibrillar regions of the nucleolus. Human NCL gene consists of 14 exons with 13 introns and spans approximately 11kb. The intron 11 of the NCL gene encodes a small nucleolar RNA, termed U20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Ncl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ncl APN 1 86356369 critical splice donor site probably null
IGL03328:Ncl APN 1 86352597 missense probably damaging 1.00
PIT4498001:Ncl UTSW 1 86351440 missense possibly damaging 0.61
R0348:Ncl UTSW 1 86356640 missense possibly damaging 0.86
R1073:Ncl UTSW 1 86350816 small insertion probably benign
R2021:Ncl UTSW 1 86356955 critical splice donor site probably null
R2022:Ncl UTSW 1 86356955 critical splice donor site probably null
R4672:Ncl UTSW 1 86356602 missense probably benign 0.04
R4900:Ncl UTSW 1 86356179 missense probably benign 0.01
R7411:Ncl UTSW 1 86350842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGCCCCATGTTTAAAGGCAG -3'
(R):5'- GCCTGCAAAACTGGGGAAAC -3'

Sequencing Primer
(F):5'- CCCCATGTTTAAAGGCAGGGAAG -3'
(R):5'- TCAGAGTAGCACTAGCACAAG -3'
Posted On2017-06-26