Incidental Mutation 'R6028:Olfr1079'
ID480151
Institutional Source Beutler Lab
Gene Symbol Olfr1079
Ensembl Gene ENSMUSG00000075179
Gene Nameolfactory receptor 1079
SynonymsMOR189-1, GA_x6K02T2Q125-48024195-48023254
MMRRC Submission 044200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86536949-86542480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86538769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 49 (I49F)
Ref Sequence ENSEMBL: ENSMUSP00000097467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099882] [ENSMUST00000111582] [ENSMUST00000216480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099882
AA Change: I49F

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097467
Gene: ENSMUSG00000075179
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 175 1.2e-7 PFAM
Pfam:7tm_1 43 292 7.1e-32 PFAM
Pfam:7tm_4 141 285 1.3e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111582
AA Change: I47F

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107208
Gene: ENSMUSG00000075179
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 1.6e-48 PFAM
Pfam:7TM_GPCR_Srsx 37 175 1.2e-7 PFAM
Pfam:7tm_1 43 292 2.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216480
AA Change: I47F

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Olfr1079
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1079 APN 2 86538330 missense probably benign 0.12
IGL02289:Olfr1079 APN 2 86538448 missense probably benign 0.07
IGL02794:Olfr1079 APN 2 86538148 missense possibly damaging 0.80
R1498:Olfr1079 UTSW 2 86538558 missense probably benign 0.00
R1923:Olfr1079 UTSW 2 86538513 missense probably damaging 1.00
R2195:Olfr1079 UTSW 2 86538903 missense probably benign 0.05
R2211:Olfr1079 UTSW 2 86538513 missense probably damaging 1.00
R2925:Olfr1079 UTSW 2 86538547 missense probably damaging 1.00
R4370:Olfr1079 UTSW 2 86538420 missense possibly damaging 0.78
R4430:Olfr1079 UTSW 2 86538387 missense probably damaging 0.98
R4678:Olfr1079 UTSW 2 86538733 missense possibly damaging 0.95
R4790:Olfr1079 UTSW 2 86538880 missense possibly damaging 0.63
R4996:Olfr1079 UTSW 2 86538271 missense probably benign 0.02
R5905:Olfr1079 UTSW 2 86538769 missense possibly damaging 0.91
R5984:Olfr1079 UTSW 2 86538168 missense probably damaging 1.00
R6878:Olfr1079 UTSW 2 86538765 missense probably damaging 1.00
R7579:Olfr1079 UTSW 2 86538528 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATAGCCACATAGCGGTCGTAAG -3'
(R):5'- ACTGTGATACTCTACTCATGATAGG -3'

Sequencing Primer
(F):5'- GACATCACAGATAGAATGAACAGTTC -3'
(R):5'- GTTTTTGAATGAATGCAGATGGAGAG -3'
Posted On2017-06-26