Incidental Mutation 'R6028:Adamtsl1'
ID480162
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission 044200-MU
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86342324 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 924 (A924E)
Ref Sequence ENSEMBL: ENSMUSP00000119278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107177
Predicted Effect probably damaging
Transcript: ENSMUST00000107178
AA Change: A932E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: A932E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141889
AA Change: A924E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: A924E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Meta Mutation Damage Score 0.5945 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
R7908:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R7934:Adamtsl1 UTSW 4 86243725 missense probably damaging 1.00
R8056:Adamtsl1 UTSW 4 86342032 missense possibly damaging 0.76
R8109:Adamtsl1 UTSW 4 86248069 missense
R8143:Adamtsl1 UTSW 4 86342255 missense possibly damaging 0.71
R8205:Adamtsl1 UTSW 4 86199413 makesense probably null
R8215:Adamtsl1 UTSW 4 86343145 missense probably benign 0.45
R8250:Adamtsl1 UTSW 4 86342609 missense probably damaging 1.00
R8261:Adamtsl1 UTSW 4 86276883 missense probably damaging 0.99
R8417:Adamtsl1 UTSW 4 86156689 missense possibly damaging 0.81
R8494:Adamtsl1 UTSW 4 86321984 missense probably damaging 0.99
R8516:Adamtsl1 UTSW 4 86342543 missense probably damaging 1.00
R8525:Adamtsl1 UTSW 4 86277010 missense probably damaging 1.00
Z1176:Adamtsl1 UTSW 4 86342177 missense probably damaging 0.99
Z1176:Adamtsl1 UTSW 4 86342693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTCCCAAGACTACCGTGGTG -3'
(R):5'- CATCATAGCGGTTCCCAGGATC -3'

Sequencing Primer
(F):5'- AAGACTACCGTGGTGCTCCG -3'
(R):5'- TTCCCAGGATCTGCAGTGAG -3'
Posted On2017-06-26