Mutagenetix > Incidental Mutations

Incidental Mutation 'R6028:Adamtsl1'

480162

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

044200-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R6028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 86342324 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 924 (A924E)

Ref Sequence

ENSEMBL: ENSMUSP00000119278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107177

Predicted Effect

probably damaging
Transcript: ENSMUST00000107178
AA Change: A932E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: A932E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141889
AA Change: A924E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: A924E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Meta Mutation Damage Score

0.5945

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	A	3: 36,479,569		probably null	Het
Acat1	A	T	9: 53,592,066	Y158N	probably damaging	Het
Adck1	A	T	12: 88,402,132	M127L	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Alad	G	T	4: 62,510,122	T305K	probably benign	Het
Ankrd33	T	C	15: 101,119,072	F65S	probably damaging	Het
Ap3d1	T	C	10: 80,722,927	N281S	possibly damaging	Het
Arhgap30	A	G	1: 171,408,320	D754G	probably benign	Het
Asah2	T	C	19: 32,016,514	D438G	probably damaging	Het
Cachd1	C	A	4: 100,983,556	N905K	probably damaging	Het
Cdh23	G	T	10: 60,534,535	D160E	probably damaging	Het
Cntln	T	A	4: 84,971,173	S298T	probably benign	Het
Dnah5	T	A	15: 28,387,833	M3146K	probably damaging	Het
Doc2b	C	A	11: 75,772,586	A347S	probably benign	Het
Eps8l2	T	C	7: 141,357,833	F422S	possibly damaging	Het
Esm1	A	G	13: 113,216,667	N161S	possibly damaging	Het
Fbxw10	C	T	11: 62,873,519	Q671*	probably null	Het
Fnbp4	C	A	2: 90,751,134	T177K	probably benign	Het
Gm11639	T	C	11: 104,769,655		probably null	Het
Gm6803	A	T	12: 88,018,361	D137E	possibly damaging	Het
Gpr137c	C	A	14: 45,277,481	Q266K	probably damaging	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hk1	C	A	10: 62,353,058	K25N	probably null	Het
Klhl29	G	T	12: 5,090,995	Y616*	probably null	Het
Lman1l	A	G	9: 57,608,263	I443T	probably damaging	Het
Lmnb1	T	G	18: 56,743,276	Y485*	probably null	Het
Lrrc63	A	G	14: 75,086,174	S537P	possibly damaging	Het
Ltbp2	T	A	12: 84,784,852	N1686I	probably damaging	Het
Map9	T	A	3: 82,380,248		probably null	Het
Marco	T	A	1: 120,490,942	Q194L	probably damaging	Het
Mc3r	A	T	2: 172,249,209	D117V	probably damaging	Het
Meltf	T	A	16: 31,887,476	D259E	possibly damaging	Het
Mical1	A	T	10: 41,486,877	M973L	probably benign	Het
Mmp21	T	C	7: 133,678,714	T176A	probably benign	Het
Mterf1b	T	A	5: 4,197,666		probably null	Het
Muc16	G	A	9: 18,657,176	S1349F	unknown	Het
Nacc2	A	G	2: 26,061,578	V415A	probably damaging	Het
Ncl	A	G	1: 86,356,133	V322A	probably benign	Het
Neb	G	A	2: 52,193,231	T1639I	probably damaging	Het
Nfia	A	G	4: 98,111,251	H485R	possibly damaging	Het
Nlrp9a	C	T	7: 26,558,337	T460I	probably benign	Het
Olfr1079	T	A	2: 86,538,769	I49F	possibly damaging	Het
Olfr938	T	A	9: 39,078,083	I221F	probably damaging	Het
Patl2	T	A	2: 122,126,137	Q158L	possibly damaging	Het
Pja2	T	C	17: 64,309,090	D270G	probably benign	Het
Pkd1l1	T	C	11: 8,836,267	H1929R	probably benign	Het
Plekhh3	A	T	11: 101,166,570	M287K	probably damaging	Het
Polb	G	T	8: 22,639,995	S187*	probably null	Het
Popdc3	A	G	10: 45,317,919	D272G	probably benign	Het
Prkar2b	A	T	12: 31,993,758	D121E	possibly damaging	Het
Psmd3	T	A	11: 98,685,665	L131Q	probably damaging	Het
Ptcd3	A	T	6: 71,898,408	C197S	probably damaging	Het
Ptprf	A	T	4: 118,213,629	V1391D	probably benign	Het
Purb	A	G	11: 6,475,150	F246S	probably damaging	Het
Rgs8	C	A	1: 153,690,988	T95N	probably damaging	Het
Slc2a13	T	C	15: 91,276,116	N545S	probably damaging	Het
Smpd2	A	G	10: 41,489,348	W51R	probably damaging	Het
Srgap1	T	C	10: 121,828,730	Q490R	probably null	Het
Strbp	G	A	2: 37,625,255	T253I	probably damaging	Het
Sult1d1	A	T	5: 87,559,826	M145K	probably damaging	Het
Taf5l	A	C	8: 124,002,975		probably null	Het
Tas2r131	T	G	6: 132,957,676	I57L	probably benign	Het
Tcf25	A	G	8: 123,381,437	N77S	possibly damaging	Het
Tmem253	A	G	14: 52,017,811	T57A	possibly damaging	Het
Tspan17	A	G	13: 54,793,298	N130S	probably damaging	Het
Utrn	T	C	10: 12,654,716	S2118G	probably benign	Het
Vmn2r3	T	A	3: 64,275,277	T334S	probably benign	Het
Wnk2	G	T	13: 49,076,345	A901E	probably damaging	Het
Zc3hav1	T	C	6: 38,307,340	T947A	probably benign	Het
Zfhx3	C	T	8: 108,793,503	P419L	probably damaging	Het
Zfp292	A	G	4: 34,819,549	S258P	probably damaging	Het
Zfp964	A	G	8: 69,663,913	T388A	unknown	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense
R7908:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R7934:Adamtsl1	UTSW	4	86243725	missense	probably damaging	1.00
R8056:Adamtsl1	UTSW	4	86342032	missense	possibly damaging	0.76
R8109:Adamtsl1	UTSW	4	86248069	missense
R8143:Adamtsl1	UTSW	4	86342255	missense	possibly damaging	0.71
R8205:Adamtsl1	UTSW	4	86199413	makesense	probably null
R8215:Adamtsl1	UTSW	4	86343145	missense	probably benign	0.45
R8250:Adamtsl1	UTSW	4	86342609	missense	probably damaging	1.00
R8261:Adamtsl1	UTSW	4	86276883	missense	probably damaging	0.99
R8417:Adamtsl1	UTSW	4	86156689	missense	possibly damaging	0.81
R8494:Adamtsl1	UTSW	4	86321984	missense	probably damaging	0.99
R8516:Adamtsl1	UTSW	4	86342543	missense	probably damaging	1.00
R8525:Adamtsl1	UTSW	4	86277010	missense	probably damaging	1.00
Z1176:Adamtsl1	UTSW	4	86342177	missense	probably damaging	0.99
Z1176:Adamtsl1	UTSW	4	86342693	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TTCCCAAGACTACCGTGGTG -3'
(R):5'- CATCATAGCGGTTCCCAGGATC -3'

Sequencing Primer
(F):5'- AAGACTACCGTGGTGCTCCG -3'
(R):5'- TTCCCAGGATCTGCAGTGAG -3'

Posted On

2017-06-26