Incidental Mutation 'R6028:Zc3hav1'
ID480167
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
MMRRC Submission 044200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38307340 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 947 (T947A)
Ref Sequence ENSEMBL: ENSMUSP00000110550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably benign
Transcript: ENSMUST00000114900
AA Change: T947A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: T947A

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143702
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1873:Zc3hav1 UTSW 6 38332757 missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38307237 missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38332393 nonsense probably null
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7506:Zc3hav1 UTSW 6 38332940 nonsense probably null
R7593:Zc3hav1 UTSW 6 38329186 missense probably benign 0.01
R7788:Zc3hav1 UTSW 6 38332756 missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7892:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
R7968:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7975:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGGAATGTAAAAGCCTACCTACTG -3'
(R):5'- TGTTACAACCTATGCTCGCTG -3'

Sequencing Primer
(F):5'- AGCCTACCTACTGTCTGAAAATG -3'
(R):5'- CAACCTATGCTCGCTGATAGTAATTC -3'
Posted On2017-06-26