Incidental Mutation 'R0513:Vps13c'
ID48017
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 038707-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0513 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67930735 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1856 (I1856L)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect probably benign
Transcript: ENSMUST00000077879
AA Change: I1856L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: I1856L

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 99% (122/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,659 T146A probably benign Het
4930452B06Rik A C 14: 8,536,609 D199E probably damaging Het
5830473C10Rik A T 5: 90,577,927 T333S probably benign Het
6720489N17Rik A C 13: 62,605,215 V99G possibly damaging Het
Abcg4 A G 9: 44,281,687 S121P possibly damaging Het
Actr2 T C 11: 20,080,124 T212A probably damaging Het
Adcy10 T A 1: 165,519,519 D368E probably benign Het
Anapc15 T C 7: 101,898,540 probably benign Het
Aox4 A G 1: 58,217,519 R67G probably benign Het
Aox4 A G 1: 58,247,300 D697G probably damaging Het
Arhgap42 A T 9: 9,005,765 S755T probably benign Het
Atm A G 9: 53,503,948 V881A probably benign Het
Cd163l1 C A 7: 140,224,960 C625* probably null Het
Cdkal1 C T 13: 29,625,965 probably benign Het
Cfap61 C A 2: 146,035,295 N491K possibly damaging Het
Chgb T C 2: 132,785,977 probably benign Het
Chrna1 C A 2: 73,568,082 probably benign Het
Chst10 A G 1: 38,865,763 L283P probably damaging Het
Clca3a1 A G 3: 144,760,562 probably null Het
Cryzl1 G T 16: 91,699,287 A1E possibly damaging Het
Csnk1a1 T C 18: 61,576,547 Y213H probably damaging Het
Cspg4 A G 9: 56,898,091 Q2062R probably benign Het
Ctnnal1 A G 4: 56,835,348 C310R probably benign Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
D930048N14Rik T C 11: 51,654,928 probably benign Het
Dag1 G A 9: 108,208,485 P486S possibly damaging Het
Dgkq A G 5: 108,656,495 L33P probably benign Het
Dlc1 C T 8: 36,584,010 G856R probably damaging Het
Dst T A 1: 34,219,531 probably benign Het
Dtl A T 1: 191,569,707 Y79* probably null Het
Egfr T G 11: 16,872,855 L406R probably damaging Het
Elp3 A T 14: 65,563,246 probably null Het
Fbxw19 C A 9: 109,481,553 probably null Het
Frs2 T C 10: 117,074,665 E264G possibly damaging Het
Fscn2 G T 11: 120,361,880 V58L probably damaging Het
Gm17324 G A 9: 78,448,725 probably benign Het
Gm4787 A T 12: 81,378,312 N357K probably benign Het
Gm9956 G T 10: 56,745,195 Het
Gsg1l C T 7: 126,020,623 probably null Het
Herc1 G A 9: 66,445,645 V2138M possibly damaging Het
Htr2a T C 14: 74,706,324 L448P probably benign Het
Ing3 C T 6: 21,970,035 S255L probably damaging Het
Ispd A T 12: 36,390,468 H125L probably damaging Het
Krt78 T C 15: 101,950,949 D271G probably damaging Het
Lmbrd2 T A 15: 9,194,729 L606H probably damaging Het
Lmod1 T A 1: 135,325,168 N53K probably damaging Het
Lsr G C 7: 30,958,338 A467G probably benign Het
Mbtd1 T A 11: 93,932,212 probably null Het
Mill1 T A 7: 18,264,877 Y337* probably null Het
Mlxipl A T 5: 135,137,263 Q833L probably benign Het
Mon2 C T 10: 123,038,610 V278M probably damaging Het
Mxra8 A C 4: 155,841,733 M180L probably benign Het
Myo18a A T 11: 77,811,594 probably benign Het
Myo1c T G 11: 75,665,831 probably null Het
Myo1g T C 11: 6,510,203 T782A probably benign Het
Ncapd3 A G 9: 27,064,105 probably benign Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nedd4l T A 18: 65,195,185 probably benign Het
Nf2 T C 11: 4,791,185 K343R possibly damaging Het
Nfasc A T 1: 132,603,846 D733E possibly damaging Het
Nolc1 G A 19: 46,084,159 D699N probably damaging Het
Nrbp2 C T 15: 76,088,976 A45T probably benign Het
Obscn A G 11: 59,061,522 V3907A possibly damaging Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1371 T C 11: 52,213,749 Q80R possibly damaging Het
Olfr145 A T 9: 37,898,055 Y217F probably damaging Het
Pank2 C T 2: 131,282,606 T290I probably damaging Het
Pbx4 T C 8: 69,864,879 V171A probably benign Het
Pcgf1 G T 6: 83,080,574 V75F probably damaging Het
Pik3ca T C 3: 32,461,511 S778P probably damaging Het
Pld6 T C 11: 59,785,221 I141M probably damaging Het
Polq T A 16: 37,094,502 V2508E probably damaging Het
Prkca C G 11: 108,014,376 D179H possibly damaging Het
Pspn T C 17: 56,999,720 S70G probably damaging Het
Ptchd4 C T 17: 42,503,746 T846I probably benign Het
Reg3g A C 6: 78,467,844 Y50* probably null Het
Rev3l C T 10: 39,828,143 H2062Y probably benign Het
Rsph4a C T 10: 33,912,991 Q611* probably null Het
Scgb1b20 G A 7: 33,373,314 probably null Het
Sfxn5 T C 6: 85,269,973 probably benign Het
Sh3tc1 T A 5: 35,700,307 Q1179L possibly damaging Het
Skint11 A G 4: 114,194,565 I37V probably benign Het
Slc35f5 T C 1: 125,576,169 probably benign Het
Slc8a2 A C 7: 16,157,339 D768A probably damaging Het
Slco6b1 A G 1: 96,997,184 noncoding transcript Het
Smurf2 T A 11: 106,836,105 T453S probably benign Het
Spag16 A G 1: 70,493,768 probably benign Het
Spindoc G A 19: 7,374,144 T205I probably benign Het
Stab1 T C 14: 31,148,945 I1316V probably benign Het
Stox2 T C 8: 47,193,865 R187G probably damaging Het
Tcea2 A C 2: 181,684,481 T93P probably benign Het
Tenm4 T C 7: 96,895,623 M2311T probably benign Het
Tmem63a A G 1: 180,960,461 Q260R probably benign Het
Tnpo2 A T 8: 85,053,529 H698L probably benign Het
Trim33 A G 3: 103,310,384 D215G probably damaging Het
Ttc3 T A 16: 94,426,212 I727N probably damaging Het
Ttn T A 2: 76,943,325 K2271N probably damaging Het
Ubr2 T A 17: 46,986,779 K223* probably null Het
Ubr4 A G 4: 139,416,875 M1410V possibly damaging Het
Ugt2b35 T C 5: 87,003,412 probably benign Het
Ulk4 T A 9: 121,152,325 H880L probably benign Het
Unc80 G A 1: 66,622,474 C1686Y possibly damaging Het
Upf2 T A 2: 5,957,667 L60Q unknown Het
Usf2 A T 7: 30,954,736 probably benign Het
Usp21 T A 1: 171,283,012 probably benign Het
Usp21 T A 1: 171,283,014 probably benign Het
Vmn2r118 T A 17: 55,610,970 K181* probably null Het
Vmn2r124 T A 17: 18,073,729 S693T possibly damaging Het
Vmn2r76 C A 7: 86,228,779 G470V probably benign Het
Vps50 C T 6: 3,520,210 L119F probably damaging Het
Wdfy3 T A 5: 101,890,789 S2012C probably damaging Het
Zfp142 A G 1: 74,571,555 V924A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp235 T C 7: 24,142,219 S688P probably damaging Het
Zfp39 C T 11: 58,889,987 V650I probably benign Het
Zfp82 A T 7: 30,056,840 N272K probably damaging Het
Zfyve21 A C 12: 111,823,264 D54A possibly damaging Het
Zfyve26 C T 12: 79,244,484 D2116N probably damaging Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCAGACAGGTTAGAAATAGCCC -3'
(R):5'- TGCTGGTTTTCAGGCACATCAGG -3'

Sequencing Primer
(F):5'- ATTTGGAACAGGGCAGTCCTC -3'
(R):5'- GTTTTCAGGCACATCAGGAACTG -3'
Posted On2013-06-12