Incidental Mutation 'R6028:Polb'
ID480173
Institutional Source Beutler Lab
Gene Symbol Polb
Ensembl Gene ENSMUSG00000031536
Gene Namepolymerase (DNA directed), beta
SynonymsPol beta, A430088C08Rik
MMRRC Submission 044200-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22628126-22653435 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 22639995 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 187 (S187*)
Ref Sequence ENSEMBL: ENSMUSP00000033938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033938] [ENSMUST00000210950]
Predicted Effect probably null
Transcript: ENSMUST00000033938
AA Change: S187*
SMART Domains Protein: ENSMUSP00000033938
Gene: ENSMUSG00000031536
AA Change: S187*

DomainStartEndE-ValueType
POLXc 10 334 4.58e-159 SMART
HhH1 57 76 1.91e-1 SMART
HhH1 98 117 1.14e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181668
Predicted Effect probably benign
Transcript: ENSMUST00000210950
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for one knock-out allele die from E10.5 to birth and those for another one exhibit embryonic growth retardation, abnormal neurogenesis, and neonatal lethality due to respiratory failure. Hypomorphic allele mice develop systemic lupus erythematosus-like phentoypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Polb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Polb APN 8 22653072 missense probably damaging 1.00
IGL02421:Polb APN 8 22640373 missense probably damaging 1.00
IGL02618:Polb APN 8 22637093 missense probably damaging 1.00
IGL02850:Polb APN 8 22648261 splice site probably benign
IGL03143:Polb APN 8 22640351 splice site probably benign
IGL02796:Polb UTSW 8 22631458 missense probably damaging 1.00
R0280:Polb UTSW 8 22640392 missense probably damaging 0.99
R0383:Polb UTSW 8 22639995 nonsense probably null
R0788:Polb UTSW 8 22642338 missense probably null
R1374:Polb UTSW 8 22653057 splice site probably benign
R1564:Polb UTSW 8 22630341 critical splice donor site probably null
R2194:Polb UTSW 8 22647467 missense probably benign 0.05
R2295:Polb UTSW 8 22653319 missense probably damaging 1.00
R2314:Polb UTSW 8 22640002 missense possibly damaging 0.69
R4992:Polb UTSW 8 22645071 missense probably damaging 0.97
R5107:Polb UTSW 8 22645046 splice site probably null
R5474:Polb UTSW 8 22630370 missense probably benign 0.13
R5905:Polb UTSW 8 22639995 nonsense probably null
R5908:Polb UTSW 8 22642303 critical splice donor site probably null
R6188:Polb UTSW 8 22647447 missense probably damaging 0.99
R7304:Polb UTSW 8 22639959 missense probably benign
R7644:Polb UTSW 8 22640427 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCAGATGCCTCTCACAGAG -3'
(R):5'- GTCTCTGTCATTGCACCTGAG -3'

Sequencing Primer
(F):5'- ATGAGGCCCTGAGTTCAATC -3'
(R):5'- CCTGAGTGATTAGACAGACAATGG -3'
Posted On2017-06-26