Incidental Mutation 'R6028:Prkar2b'
ID480198
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Nameprotein kinase, cAMP dependent regulatory, type II beta
SynonymsRII(beta), Pkarb2, PKARIIbeta
MMRRC Submission 044200-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31958476-32061296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31993758 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 121 (D121E)
Ref Sequence ENSEMBL: ENSMUSP00000039797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003079
AA Change: D121E

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997
AA Change: D121E

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000036497
AA Change: D121E

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997
AA Change: D121E

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146865
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32061072 missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 31975910 splice site probably benign
IGL02071:Prkar2b APN 12 31963017 missense probably damaging 1.00
IGL02118:Prkar2b APN 12 31975964 missense probably damaging 1.00
spark UTSW 12 31987974 splice site probably null
R0211:Prkar2b UTSW 12 31972184 missense probably benign 0.30
R0362:Prkar2b UTSW 12 31987974 splice site probably null
R0485:Prkar2b UTSW 12 31976035 splice site probably benign
R0898:Prkar2b UTSW 12 31963002 missense possibly damaging 0.90
R1426:Prkar2b UTSW 12 31962988 splice site probably benign
R1997:Prkar2b UTSW 12 31963935 missense probably damaging 0.99
R2114:Prkar2b UTSW 12 31967280 missense probably damaging 1.00
R2346:Prkar2b UTSW 12 31972150 missense probably benign 0.01
R2513:Prkar2b UTSW 12 31975929 missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 31965123 missense probably benign 0.01
R5301:Prkar2b UTSW 12 31975928 missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32060985 missense probably damaging 0.97
R5351:Prkar2b UTSW 12 31972127 missense probably damaging 1.00
R6025:Prkar2b UTSW 12 32060856 missense possibly damaging 0.68
R6563:Prkar2b UTSW 12 31993786 splice site probably null
R7074:Prkar2b UTSW 12 31972148 missense probably damaging 1.00
R7431:Prkar2b UTSW 12 31963151 splice site probably null
R7747:Prkar2b UTSW 12 32060938 missense probably benign 0.23
R7978:Prkar2b UTSW 12 31963025 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATCCAAAAGCGACTCTGGG -3'
(R):5'- TCTGGTACCATGGAAGCTAGTTC -3'

Sequencing Primer
(F):5'- CGACTCTGGGGTTTTAAAAAGAAGTC -3'
(R):5'- ACCATGGAAGCTAGTTCTCGGG -3'
Posted On2017-06-26