Mutagenetix > Incidental Mutations

Incidental Mutation 'R6028:Ltbp2'

480199

Institutional Source

Beutler Lab

Gene Symbol

Ltbp2

Ensembl Gene

ENSMUSG00000002020

Gene Name

latent transforming growth factor beta binding protein 2

Synonyms

MMRRC Submission

044200-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.812) question?

Stock #

R6028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84783212-84876532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84784852 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1686 (N1686I)

Ref Sequence

ENSEMBL: ENSMUSP00000127693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000166383]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002073
AA Change: N1729I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: N1729I

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	546	582	3.8e-9	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	666	707	3.4e-17	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	917	1.75e-10	SMART
EGF_CA	918	957	1.53e-10	SMART
EGF_CA	958	997	3.51e-10	SMART
EGF_CA	998	1038	8.3e-12	SMART
EGF_CA	1039	1080	4.56e-9	SMART
EGF_CA	1081	1122	4.56e-9	SMART
EGF_CA	1123	1163	8.76e-11	SMART
EGF_CA	1164	1205	4.38e-11	SMART
EGF_CA	1206	1246	1.75e-10	SMART
EGF_CA	1247	1290	2.24e-8	SMART
EGF_CA	1291	1332	6.01e-9	SMART
EGF	1336	1375	1.95e1	SMART
Pfam:TB	1410	1450	1.4e-13	PFAM
EGF_CA	1473	1515	2.31e-10	SMART
EGF_CA	1516	1555	7.93e-9	SMART
Pfam:TB	1582	1623	1e-13	PFAM
low complexity region	1691	1704	N/A	INTRINSIC
EGF	1724	1761	4e-5	SMART
EGF_CA	1762	1806	1.91e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110254
AA Change: N1706I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: N1706I

Domain	Start	End	E-Value	Type
low complexity region	119	128	N/A	INTRINSIC
EGF	204	233	6.55e-1	SMART
low complexity region	275	295	N/A	INTRINSIC
EGF	404	433	8.19e-2	SMART
low complexity region	535	546	N/A	INTRINSIC
Pfam:TB	565	602	4e-8	PFAM
EGF_CA	626	666	8.05e-10	SMART
Pfam:TB	685	727	3.7e-16	PFAM
EGF_CA	852	894	7.18e-7	SMART
EGF_CA	895	934	1.53e-10	SMART
EGF_CA	935	974	3.51e-10	SMART
EGF_CA	975	1015	8.3e-12	SMART
EGF_CA	1016	1057	4.56e-9	SMART
EGF_CA	1058	1099	4.56e-9	SMART
EGF_CA	1100	1140	8.76e-11	SMART
EGF_CA	1141	1182	4.38e-11	SMART
EGF_CA	1183	1223	1.75e-10	SMART
EGF_CA	1224	1267	2.24e-8	SMART
EGF_CA	1268	1309	6.01e-9	SMART
EGF	1313	1352	1.95e1	SMART
Pfam:TB	1387	1427	1.4e-11	PFAM
EGF_CA	1450	1492	2.31e-10	SMART
EGF_CA	1493	1532	7.93e-9	SMART
Pfam:TB	1558	1600	4.6e-13	PFAM
low complexity region	1668	1681	N/A	INTRINSIC
EGF	1701	1738	4e-5	SMART
EGF_CA	1739	1783	1.91e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163189
AA Change: N1686I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: N1686I

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	545	582	4e-8	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	665	707	3.8e-16	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	914	1.53e-10	SMART
EGF_CA	915	954	3.51e-10	SMART
EGF_CA	955	995	8.3e-12	SMART
EGF_CA	996	1037	4.56e-9	SMART
EGF_CA	1038	1079	4.56e-9	SMART
EGF_CA	1080	1120	8.76e-11	SMART
EGF_CA	1121	1162	4.38e-11	SMART
EGF_CA	1163	1203	1.75e-10	SMART
EGF_CA	1204	1247	2.24e-8	SMART
EGF_CA	1248	1289	6.01e-9	SMART
EGF	1293	1332	1.95e1	SMART
Pfam:TB	1367	1407	1.5e-11	PFAM
EGF_CA	1430	1472	2.31e-10	SMART
EGF_CA	1473	1512	7.93e-9	SMART
Pfam:TB	1538	1580	4.7e-13	PFAM
low complexity region	1648	1661	N/A	INTRINSIC
EGF	1681	1718	4e-5	SMART
EGF_CA	1719	1763	1.91e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163214

SMART Domains

Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	6	46	8.76e-11	SMART
EGF_CA	47	90	2.24e-8	SMART
EGF_CA	91	132	6.01e-9	SMART
EGF	136	175	1.95e1	SMART
Pfam:TB	210	250	1.5e-14	PFAM
EGF	276	307	1.5e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166383

SMART Domains

Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	8	49	2.13e-9	SMART
Pfam:TB	75	117	1.3e-14	PFAM
low complexity region	185	198	N/A	INTRINSIC

Meta Mutation Damage Score

0.6101

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	A	3: 36,479,569		probably null	Het
Acat1	A	T	9: 53,592,066	Y158N	probably damaging	Het
Adamtsl1	C	A	4: 86,342,324	A924E	probably damaging	Het
Adck1	A	T	12: 88,402,132	M127L	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Alad	G	T	4: 62,510,122	T305K	probably benign	Het
Ankrd33	T	C	15: 101,119,072	F65S	probably damaging	Het
Ap3d1	T	C	10: 80,722,927	N281S	possibly damaging	Het
Arhgap30	A	G	1: 171,408,320	D754G	probably benign	Het
Asah2	T	C	19: 32,016,514	D438G	probably damaging	Het
Cachd1	C	A	4: 100,983,556	N905K	probably damaging	Het
Cdh23	G	T	10: 60,534,535	D160E	probably damaging	Het
Cntln	T	A	4: 84,971,173	S298T	probably benign	Het
Dnah5	T	A	15: 28,387,833	M3146K	probably damaging	Het
Doc2b	C	A	11: 75,772,586	A347S	probably benign	Het
Eps8l2	T	C	7: 141,357,833	F422S	possibly damaging	Het
Esm1	A	G	13: 113,216,667	N161S	possibly damaging	Het
Fbxw10	C	T	11: 62,873,519	Q671*	probably null	Het
Fnbp4	C	A	2: 90,751,134	T177K	probably benign	Het
Gm11639	T	C	11: 104,769,655		probably null	Het
Gm6803	A	T	12: 88,018,361	D137E	possibly damaging	Het
Gpr137c	C	A	14: 45,277,481	Q266K	probably damaging	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hk1	C	A	10: 62,353,058	K25N	probably null	Het
Klhl29	G	T	12: 5,090,995	Y616*	probably null	Het
Lman1l	A	G	9: 57,608,263	I443T	probably damaging	Het
Lmnb1	T	G	18: 56,743,276	Y485*	probably null	Het
Lrrc63	A	G	14: 75,086,174	S537P	possibly damaging	Het
Map9	T	A	3: 82,380,248		probably null	Het
Marco	T	A	1: 120,490,942	Q194L	probably damaging	Het
Mc3r	A	T	2: 172,249,209	D117V	probably damaging	Het
Meltf	T	A	16: 31,887,476	D259E	possibly damaging	Het
Mical1	A	T	10: 41,486,877	M973L	probably benign	Het
Mmp21	T	C	7: 133,678,714	T176A	probably benign	Het
Mterf1b	T	A	5: 4,197,666		probably null	Het
Muc16	G	A	9: 18,657,176	S1349F	unknown	Het
Nacc2	A	G	2: 26,061,578	V415A	probably damaging	Het
Ncl	A	G	1: 86,356,133	V322A	probably benign	Het
Neb	G	A	2: 52,193,231	T1639I	probably damaging	Het
Nfia	A	G	4: 98,111,251	H485R	possibly damaging	Het
Nlrp9a	C	T	7: 26,558,337	T460I	probably benign	Het
Olfr1079	T	A	2: 86,538,769	I49F	possibly damaging	Het
Olfr938	T	A	9: 39,078,083	I221F	probably damaging	Het
Patl2	T	A	2: 122,126,137	Q158L	possibly damaging	Het
Pja2	T	C	17: 64,309,090	D270G	probably benign	Het
Pkd1l1	T	C	11: 8,836,267	H1929R	probably benign	Het
Plekhh3	A	T	11: 101,166,570	M287K	probably damaging	Het
Polb	G	T	8: 22,639,995	S187*	probably null	Het
Popdc3	A	G	10: 45,317,919	D272G	probably benign	Het
Prkar2b	A	T	12: 31,993,758	D121E	possibly damaging	Het
Psmd3	T	A	11: 98,685,665	L131Q	probably damaging	Het
Ptcd3	A	T	6: 71,898,408	C197S	probably damaging	Het
Ptprf	A	T	4: 118,213,629	V1391D	probably benign	Het
Purb	A	G	11: 6,475,150	F246S	probably damaging	Het
Rgs8	C	A	1: 153,690,988	T95N	probably damaging	Het
Slc2a13	T	C	15: 91,276,116	N545S	probably damaging	Het
Smpd2	A	G	10: 41,489,348	W51R	probably damaging	Het
Srgap1	T	C	10: 121,828,730	Q490R	probably null	Het
Strbp	G	A	2: 37,625,255	T253I	probably damaging	Het
Sult1d1	A	T	5: 87,559,826	M145K	probably damaging	Het
Taf5l	A	C	8: 124,002,975		probably null	Het
Tas2r131	T	G	6: 132,957,676	I57L	probably benign	Het
Tcf25	A	G	8: 123,381,437	N77S	possibly damaging	Het
Tmem253	A	G	14: 52,017,811	T57A	possibly damaging	Het
Tspan17	A	G	13: 54,793,298	N130S	probably damaging	Het
Utrn	T	C	10: 12,654,716	S2118G	probably benign	Het
Vmn2r3	T	A	3: 64,275,277	T334S	probably benign	Het
Wnk2	G	T	13: 49,076,345	A901E	probably damaging	Het
Zc3hav1	T	C	6: 38,307,340	T947A	probably benign	Het
Zfhx3	C	T	8: 108,793,503	P419L	probably damaging	Het
Zfp292	A	G	4: 34,819,549	S258P	probably damaging	Het
Zfp964	A	G	8: 69,663,913	T388A	unknown	Het

Other mutations in Ltbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Ltbp2	APN	12	84791064	missense	probably damaging	1.00
IGL00938:Ltbp2	APN	12	84831799	missense	probably benign	0.03
IGL01397:Ltbp2	APN	12	84790268	missense	probably damaging	1.00
IGL01570:Ltbp2	APN	12	84794033	missense	probably benign	0.05
IGL01631:Ltbp2	APN	12	84809146	critical splice donor site	probably null
IGL01662:Ltbp2	APN	12	84809246	missense	probably benign	0.00
IGL01728:Ltbp2	APN	12	84791009	missense	probably damaging	0.99
IGL01839:Ltbp2	APN	12	84793658	missense	possibly damaging	0.48
IGL01946:Ltbp2	APN	12	84830748	missense	probably damaging	1.00
IGL01977:Ltbp2	APN	12	84830199	missense	probably damaging	1.00
IGL02220:Ltbp2	APN	12	84829309	missense	possibly damaging	0.93
IGL02340:Ltbp2	APN	12	84792955	critical splice donor site	probably null
IGL02430:Ltbp2	APN	12	84799401	missense	probably damaging	1.00
IGL02492:Ltbp2	APN	12	84809665	missense	probably damaging	1.00
IGL02517:Ltbp2	APN	12	84785317	missense	probably benign	0.42
IGL02794:Ltbp2	APN	12	84791935	missense	probably damaging	1.00
deft	UTSW	12	84853912	missense	probably damaging	0.98
R0045:Ltbp2	UTSW	12	84809587	missense	probably damaging	1.00
R0045:Ltbp2	UTSW	12	84813288	missense	probably damaging	1.00
R0091:Ltbp2	UTSW	12	84793733	missense	probably damaging	1.00
R0094:Ltbp2	UTSW	12	84799426	missense	probably damaging	1.00
R0166:Ltbp2	UTSW	12	84786358	missense	probably benign	0.28
R0265:Ltbp2	UTSW	12	84785969	splice site	probably null
R0394:Ltbp2	UTSW	12	84806424	splice site	probably benign
R0535:Ltbp2	UTSW	12	84784858	missense	probably damaging	1.00
R0535:Ltbp2	UTSW	12	84791052	missense	probably damaging	1.00
R1465:Ltbp2	UTSW	12	84813300	missense	probably damaging	1.00
R1465:Ltbp2	UTSW	12	84813300	missense	probably damaging	1.00
R1513:Ltbp2	UTSW	12	84791944	missense	probably damaging	1.00
R1858:Ltbp2	UTSW	12	84830781	nonsense	probably null
R1880:Ltbp2	UTSW	12	84829271	missense	probably benign	0.45
R1894:Ltbp2	UTSW	12	84787961	missense	probably damaging	1.00
R1900:Ltbp2	UTSW	12	84830658	missense	probably damaging	1.00
R1903:Ltbp2	UTSW	12	84830105	missense	probably benign	0.01
R1912:Ltbp2	UTSW	12	84785863	missense	probably damaging	0.98
R1993:Ltbp2	UTSW	12	84808446	critical splice acceptor site	probably null
R1995:Ltbp2	UTSW	12	84808446	critical splice acceptor site	probably null
R2069:Ltbp2	UTSW	12	84793733	missense	probably damaging	1.00
R2126:Ltbp2	UTSW	12	84785709	unclassified	probably null
R2139:Ltbp2	UTSW	12	84815979	missense	probably damaging	1.00
R2341:Ltbp2	UTSW	12	84809163	missense	probably benign	0.08
R2511:Ltbp2	UTSW	12	84804409	synonymous	probably null
R3737:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3738:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3739:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3889:Ltbp2	UTSW	12	84784907	unclassified	probably benign
R4034:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R4542:Ltbp2	UTSW	12	84831819	nonsense	probably null
R4621:Ltbp2	UTSW	12	84809348	missense	probably damaging	1.00
R4623:Ltbp2	UTSW	12	84809348	missense	probably damaging	1.00
R4831:Ltbp2	UTSW	12	84793640	missense	possibly damaging	0.55
R5080:Ltbp2	UTSW	12	84803864	missense	probably damaging	1.00
R5116:Ltbp2	UTSW	12	84809737	missense	probably damaging	1.00
R5351:Ltbp2	UTSW	12	84790358	missense	possibly damaging	0.95
R5445:Ltbp2	UTSW	12	84809654	missense	probably null	1.00
R5608:Ltbp2	UTSW	12	84787464	intron	probably null
R5784:Ltbp2	UTSW	12	84868739	missense	probably damaging	1.00
R5838:Ltbp2	UTSW	12	84789101	missense	probably benign	0.16
R5859:Ltbp2	UTSW	12	84794063	missense	possibly damaging	0.52
R6004:Ltbp2	UTSW	12	84876149	missense	probably benign	0.00
R6347:Ltbp2	UTSW	12	84853912	missense	probably damaging	0.98
R6615:Ltbp2	UTSW	12	84813317	missense	probably damaging	1.00
R6636:Ltbp2	UTSW	12	84875838	missense	probably benign	0.00
R6637:Ltbp2	UTSW	12	84875838	missense	probably benign	0.00
R6755:Ltbp2	UTSW	12	84795073	missense	probably damaging	1.00
R6759:Ltbp2	UTSW	12	84787410	missense	probably damaging	0.99
R6806:Ltbp2	UTSW	12	84809238	missense	possibly damaging	0.74
R6968:Ltbp2	UTSW	12	84789083	critical splice donor site	probably null
R7084:Ltbp2	UTSW	12	84868685	missense	probably damaging	1.00
R7250:Ltbp2	UTSW	12	84787392	nonsense	probably null
R7374:Ltbp2	UTSW	12	84830175	missense	probably damaging	1.00
R7501:Ltbp2	UTSW	12	84830645	missense	probably damaging	1.00
R7523:Ltbp2	UTSW	12	84791034	missense	probably benign	0.00
R7754:Ltbp2	UTSW	12	84813238	critical splice donor site	probably null
R7827:Ltbp2	UTSW	12	84789881	missense	probably benign	0.19
R8042:Ltbp2	UTSW	12	84791899	missense	probably damaging	0.99
X0017:Ltbp2	UTSW	12	84828528	missense	probably damaging	1.00
X0026:Ltbp2	UTSW	12	84830199	missense	probably damaging	1.00
Z1176:Ltbp2	UTSW	12	84875853	missense	probably benign	0.01
Z1177:Ltbp2	UTSW	12	84829316	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGGGGCTTCCACTTTCACTAG -3'
(R):5'- TGTTGCGATCCACTGACAACC -3'

Sequencing Primer
(F):5'- ACTTTCACTAGCTTGACACACG -3'
(R):5'- TGACAACCCCACCCTCGG -3'

Posted On

2017-06-26