Mutagenetix > Incidental Mutation

Incidental Mutation 'R0513:Rev3l'

48021

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

038707-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0513 (G1)

Quality Score

154

Status

Validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 39828143 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 2062 (H2062Y)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000019986
AA Change: H2062Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: H2062Y

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803
AA Change: H188Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841
AA Change: H188Y

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145333

Predicted Effect

probably benign
Transcript: ENSMUST00000164763
AA Change: H2062Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: H2062Y

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Meta Mutation Damage Score

0.0701

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.6%
20x: 92.9%

Validation Efficiency

99% (122/123)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,469,659	T146A	probably benign	Het
4930452B06Rik	A	C	14: 8,536,609	D199E	probably damaging	Het
5830473C10Rik	A	T	5: 90,577,927	T333S	probably benign	Het
6720489N17Rik	A	C	13: 62,605,215	V99G	possibly damaging	Het
Abcg4	A	G	9: 44,281,687	S121P	possibly damaging	Het
Actr2	T	C	11: 20,080,124	T212A	probably damaging	Het
Adcy10	T	A	1: 165,519,519	D368E	probably benign	Het
Anapc15	T	C	7: 101,898,540		probably benign	Het
Aox4	A	G	1: 58,217,519	R67G	probably benign	Het
Aox4	A	G	1: 58,247,300	D697G	probably damaging	Het
Arhgap42	A	T	9: 9,005,765	S755T	probably benign	Het
Atm	A	G	9: 53,503,948	V881A	probably benign	Het
Cd163l1	C	A	7: 140,224,960	C625*	probably null	Het
Cdkal1	C	T	13: 29,625,965		probably benign	Het
Cfap61	C	A	2: 146,035,295	N491K	possibly damaging	Het
Chgb	T	C	2: 132,785,977		probably benign	Het
Chrna1	C	A	2: 73,568,082		probably benign	Het
Chst10	A	G	1: 38,865,763	L283P	probably damaging	Het
Clca3a1	A	G	3: 144,760,562		probably null	Het
Cryzl1	G	T	16: 91,699,287	A1E	possibly damaging	Het
Csnk1a1	T	C	18: 61,576,547	Y213H	probably damaging	Het
Cspg4	A	G	9: 56,898,091	Q2062R	probably benign	Het
Ctnnal1	A	G	4: 56,835,348	C310R	probably benign	Het
D630003M21Rik	T	C	2: 158,200,308	E906G	probably benign	Het
D930048N14Rik	T	C	11: 51,654,928		probably benign	Het
Dag1	G	A	9: 108,208,485	P486S	possibly damaging	Het
Dgkq	A	G	5: 108,656,495	L33P	probably benign	Het
Dlc1	C	T	8: 36,584,010	G856R	probably damaging	Het
Dst	T	A	1: 34,219,531		probably benign	Het
Dtl	A	T	1: 191,569,707	Y79*	probably null	Het
Egfr	T	G	11: 16,872,855	L406R	probably damaging	Het
Elp3	A	T	14: 65,563,246		probably null	Het
Fbxw19	C	A	9: 109,481,553		probably null	Het
Frs2	T	C	10: 117,074,665	E264G	possibly damaging	Het
Fscn2	G	T	11: 120,361,880	V58L	probably damaging	Het
Gm17324	G	A	9: 78,448,725		probably benign	Het
Gm4787	A	T	12: 81,378,312	N357K	probably benign	Het
Gm9956	G	T	10: 56,745,195			Het
Gsg1l	C	T	7: 126,020,623		probably null	Het
Herc1	G	A	9: 66,445,645	V2138M	possibly damaging	Het
Htr2a	T	C	14: 74,706,324	L448P	probably benign	Het
Ing3	C	T	6: 21,970,035	S255L	probably damaging	Het
Ispd	A	T	12: 36,390,468	H125L	probably damaging	Het
Krt78	T	C	15: 101,950,949	D271G	probably damaging	Het
Lmbrd2	T	A	15: 9,194,729	L606H	probably damaging	Het
Lmod1	T	A	1: 135,325,168	N53K	probably damaging	Het
Lsr	G	C	7: 30,958,338	A467G	probably benign	Het
Mbtd1	T	A	11: 93,932,212		probably null	Het
Mill1	T	A	7: 18,264,877	Y337*	probably null	Het
Mlxipl	A	T	5: 135,137,263	Q833L	probably benign	Het
Mon2	C	T	10: 123,038,610	V278M	probably damaging	Het
Mxra8	A	C	4: 155,841,733	M180L	probably benign	Het
Myo18a	A	T	11: 77,811,594		probably benign	Het
Myo1c	T	G	11: 75,665,831		probably null	Het
Myo1g	T	C	11: 6,510,203	T782A	probably benign	Het
Ncapd3	A	G	9: 27,064,105		probably benign	Het
Neb	T	C	2: 52,308,687	D414G	probably damaging	Het
Nedd4l	T	A	18: 65,195,185		probably benign	Het
Nf2	T	C	11: 4,791,185	K343R	possibly damaging	Het
Nfasc	A	T	1: 132,603,846	D733E	possibly damaging	Het
Nolc1	G	A	19: 46,084,159	D699N	probably damaging	Het
Nrbp2	C	T	15: 76,088,976	A45T	probably benign	Het
Obscn	A	G	11: 59,061,522	V3907A	possibly damaging	Het
Olfr11	A	T	13: 21,638,949	D191E	probably benign	Het
Olfr1371	T	C	11: 52,213,749	Q80R	possibly damaging	Het
Olfr145	A	T	9: 37,898,055	Y217F	probably damaging	Het
Pank2	C	T	2: 131,282,606	T290I	probably damaging	Het
Pbx4	T	C	8: 69,864,879	V171A	probably benign	Het
Pcgf1	G	T	6: 83,080,574	V75F	probably damaging	Het
Pik3ca	T	C	3: 32,461,511	S778P	probably damaging	Het
Pld6	T	C	11: 59,785,221	I141M	probably damaging	Het
Polq	T	A	16: 37,094,502	V2508E	probably damaging	Het
Prkca	C	G	11: 108,014,376	D179H	possibly damaging	Het
Pspn	T	C	17: 56,999,720	S70G	probably damaging	Het
Ptchd4	C	T	17: 42,503,746	T846I	probably benign	Het
Reg3g	A	C	6: 78,467,844	Y50*	probably null	Het
Rsph4a	C	T	10: 33,912,991	Q611*	probably null	Het
Scgb1b20	G	A	7: 33,373,314		probably null	Het
Sfxn5	T	C	6: 85,269,973		probably benign	Het
Sh3tc1	T	A	5: 35,700,307	Q1179L	possibly damaging	Het
Skint11	A	G	4: 114,194,565	I37V	probably benign	Het
Slc35f5	T	C	1: 125,576,169		probably benign	Het
Slc8a2	A	C	7: 16,157,339	D768A	probably damaging	Het
Slco6b1	A	G	1: 96,997,184		noncoding transcript	Het
Smurf2	T	A	11: 106,836,105	T453S	probably benign	Het
Spag16	A	G	1: 70,493,768		probably benign	Het
Spindoc	G	A	19: 7,374,144	T205I	probably benign	Het
Stab1	T	C	14: 31,148,945	I1316V	probably benign	Het
Stox2	T	C	8: 47,193,865	R187G	probably damaging	Het
Tcea2	A	C	2: 181,684,481	T93P	probably benign	Het
Tenm4	T	C	7: 96,895,623	M2311T	probably benign	Het
Tmem63a	A	G	1: 180,960,461	Q260R	probably benign	Het
Tnpo2	A	T	8: 85,053,529	H698L	probably benign	Het
Trim33	A	G	3: 103,310,384	D215G	probably damaging	Het
Ttc3	T	A	16: 94,426,212	I727N	probably damaging	Het
Ttn	T	A	2: 76,943,325	K2271N	probably damaging	Het
Ubr2	T	A	17: 46,986,779	K223*	probably null	Het
Ubr4	A	G	4: 139,416,875	M1410V	possibly damaging	Het
Ugt2b35	T	C	5: 87,003,412		probably benign	Het
Ulk4	T	A	9: 121,152,325	H880L	probably benign	Het
Unc80	G	A	1: 66,622,474	C1686Y	possibly damaging	Het
Upf2	T	A	2: 5,957,667	L60Q	unknown	Het
Usf2	A	T	7: 30,954,736		probably benign	Het
Usp21	T	A	1: 171,283,012		probably benign	Het
Usp21	T	A	1: 171,283,014		probably benign	Het
Vmn2r118	T	A	17: 55,610,970	K181*	probably null	Het
Vmn2r124	T	A	17: 18,073,729	S693T	possibly damaging	Het
Vmn2r76	C	A	7: 86,228,779	G470V	probably benign	Het
Vps13c	A	C	9: 67,930,735	I1856L	probably benign	Het
Vps50	C	T	6: 3,520,210	L119F	probably damaging	Het
Wdfy3	T	A	5: 101,890,789	S2012C	probably damaging	Het
Zfp142	A	G	1: 74,571,555	V924A	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp235	T	C	7: 24,142,219	S688P	probably damaging	Het
Zfp39	C	T	11: 58,889,987	V650I	probably benign	Het
Zfp82	A	T	7: 30,056,840	N272K	probably damaging	Het
Zfyve21	A	C	12: 111,823,264	D54A	possibly damaging	Het
Zfyve26	C	T	12: 79,244,484	D2116N	probably damaging	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
R9646:Rev3l	UTSW	10	39822444	missense	probably damaging	1.00
R9686:Rev3l	UTSW	10	39867388	missense	possibly damaging	0.67
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GGAAACTCGACTTCCAAACGACCTG -3'
(R):5'- GCCAAGGTGGAATACCTGGAGAATC -3'

Sequencing Primer
(F):5'- TATGCTCCAAGTCGGCAACTG -3'
(R):5'- TCAGGGGAGCTGTAACTAACATAAC -3'

Posted On

2013-06-12