Mutagenetix > Incidental Mutation

Incidental Mutation 'R6029:Plxna2'

480226

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

044201-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6029 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 194799575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 1451 (K1451M)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027952
AA Change: K1451M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: K1451M

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Meta Mutation Damage Score

0.2648

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.7%

Validation Efficiency

97% (87/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	G	A	2: 68,694,026		probably null	Het
4933402N22Rik	A	T	5: 11,920,713	L84F	probably damaging	Het
9930021J03Rik	A	G	19: 29,754,967		probably benign	Het
Adi1	G	A	12: 28,679,319		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Apob	A	G	12: 8,016,243	E4371G	probably damaging	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,480,990	C2538W	possibly damaging	Het
Btbd16	T	C	7: 130,819,072	V353A	probably benign	Het
Cad	C	T	5: 31,054,983	S10L	possibly damaging	Het
Cdc42bpa	T	C	1: 180,111,787	S877P	probably damaging	Het
Cep152	A	T	2: 125,563,632	V1660D	probably benign	Het
Clrn2	G	T	5: 45,460,186	G133V	probably damaging	Het
Clstn2	T	C	9: 97,456,581	I842V	probably benign	Het
Cpt1c	C	T	7: 44,965,124	A434T	probably benign	Het
D130052B06Rik	G	T	11: 33,623,477	V70L	possibly damaging	Het
Dlg1	T	A	16: 31,793,570	V317E	probably damaging	Het
Dock10	T	C	1: 80,536,946	E1084G	possibly damaging	Het
Dync2h1	A	G	9: 7,157,646	V827A	probably benign	Het
E030030I06Rik	A	G	10: 22,148,933	L27P	unknown	Het
Ero1lb	T	A	13: 12,574,833	L39Q	probably damaging	Het
Erp27	T	C	6: 136,911,611	D123G	probably damaging	Het
Fasn	G	T	11: 120,820,909	F148L	probably damaging	Het
Fbxl5	T	C	5: 43,765,404	E218G	probably damaging	Het
Fbxw28	A	T	9: 109,329,425	D210E	probably damaging	Het
Gm10653	T	A	9: 62,841,514		probably benign	Het
Gm17067	A	G	7: 42,708,130	L316S	probably benign	Het
Gm29106	T	C	1: 118,200,260	S561P	probably damaging	Het
H2afy2	T	C	10: 61,747,762	T200A	possibly damaging	Het
Hmcn1	C	A	1: 150,632,437	K3699N	probably benign	Het
Itch	T	A	2: 155,179,089		probably null	Het
Itpr3	C	T	17: 27,098,171	A800V	probably damaging	Het
Kdm2b	A	T	5: 122,879,587	M1052K	probably damaging	Het
Kdm4b	T	C	17: 56,396,576	M712T	probably damaging	Het
Kmt5b	A	G	19: 3,802,104	E137G	probably damaging	Het
Krt33a	G	A	11: 100,012,463	T251I	probably benign	Het
Lrrc4b	G	T	7: 44,462,330	R542L	probably benign	Het
Macf1	C	A	4: 123,507,333	S653I	probably damaging	Het
Macrod2	G	A	2: 142,318,447	V408M	probably damaging	Het
Mapkapk3	G	T	9: 107,289,226	A40E	possibly damaging	Het
Mmp20	G	A	9: 7,639,301	V157I	probably benign	Het
Mrps28	T	C	3: 8,923,745	R18G	possibly damaging	Het
Msrb2	T	A	2: 19,394,311	C162S	probably damaging	Het
Nat6	A	G	9: 107,583,554	Y216C	probably damaging	Het
Nckap5	T	G	1: 126,025,786	T1078P	possibly damaging	Het
Nectin3	T	C	16: 46,436,400	Y91C	probably benign	Het
Nf2	G	T	11: 4,784,566		probably null	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1209	T	C	2: 88,910,036	D119G	probably damaging	Het
Olfr1288	T	A	2: 111,478,965	Y60*	probably null	Het
Olfr1380	A	T	11: 49,564,601	I227F	possibly damaging	Het
Olfr149	G	A	9: 39,702,400	A123V	probably damaging	Het
Olfr537-ps1	A	T	7: 140,538,876	M120L	unknown	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Oxr1	T	G	15: 41,825,901	L507W	probably damaging	Het
Pofut1	G	A	2: 153,259,793		probably null	Het
Ppp1r16b	T	C	2: 158,755,217	V257A	possibly damaging	Het
Prss56	G	A	1: 87,187,557	W498*	probably null	Het
Ptpru	A	G	4: 131,771,293	F1329S	probably damaging	Het
Pusl1	A	G	4: 155,889,463	F278S	probably damaging	Het
Qars	A	T	9: 108,513,690	L470F	probably damaging	Het
Rbm8a2	T	C	1: 175,978,746	D55G	probably benign	Het
Rora	T	A	9: 69,364,452	N181K	probably benign	Het
Rufy3	A	G	5: 88,627,255	D262G	probably damaging	Het
Sh3gl2	G	A	4: 85,381,414	V212M	probably damaging	Het
Sis	G	A	3: 72,928,308	T907I	probably benign	Het
Slc38a3	A	T	9: 107,652,175	I456N	probably damaging	Het
Slc4a8	T	A	15: 100,807,339	C809S	probably benign	Het
Snap91	A	T	9: 86,825,080		probably null	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Spry1	T	C	3: 37,642,848	I80T	possibly damaging	Het
St8sia2	A	G	7: 73,960,710	L275P	possibly damaging	Het
Supt7l	C	A	5: 31,526,987		probably null	Het
Tdo2	T	A	3: 81,961,440	K304N	probably damaging	Het
Tdrd12	A	T	7: 35,485,230	Y753N	probably damaging	Het
Topbp1	A	T	9: 103,344,953	Q1341L	probably benign	Het
Trim14	G	T	4: 46,506,998	A406E	probably benign	Het
Trp63	C	T	16: 25,868,214	R393W	probably damaging	Het
Trrap	T	C	5: 144,817,679	V1932A	possibly damaging	Het
Trrap	T	C	5: 144,825,914	M2399T	possibly damaging	Het
Unc45b	A	G	11: 82,913,327	N110S	probably damaging	Het
Usp32	G	T	11: 85,025,582	H845Q	probably damaging	Het
Usp44	G	A	10: 93,846,632	D268N	probably damaging	Het
Vmn1r18	T	G	6: 57,390,466	R34S	possibly damaging	Het
Vmn2r103	T	A	17: 19,794,216	Y423*	probably null	Het
Wapl	A	T	14: 34,739,247	E1054V	possibly damaging	Het
Zbtb8b	A	G	4: 129,428,493	Y392H	probably damaging	Het
Zdhhc2	A	T	8: 40,472,927	Q321L	probably null	Het
Zfp983	A	G	17: 21,662,485	D443G	probably benign	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AAGAGCTCATTCCTGGCCAG -3'
(R):5'- TCAGGTCAGAGAATATGGATCTTGC -3'

Sequencing Primer
(F):5'- CCAGTCACTTCTAATTATTGCTGGAG -3'
(R):5'- CAGAGAATATGGATCTTGCCTGGC -3'

Posted On

2017-06-26