Incidental Mutation 'R6029:Wapl'
ID480287
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 044201-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6029 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34739247 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1054 (E1054V)
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: E1054V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: E1054V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090027
AA Change: E1048V

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: E1048V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect unknown
Transcript: ENSMUST00000151285
AA Change: E283V
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: E283V

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: E1054V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: E1054V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174559
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Meta Mutation Damage Score 0.5941 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,694,026 probably null Het
4933402N22Rik A T 5: 11,920,713 L84F probably damaging Het
9930021J03Rik A G 19: 29,754,967 probably benign Het
Adi1 G A 12: 28,679,319 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Apob A G 12: 8,016,243 E4371G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,480,990 C2538W possibly damaging Het
Btbd16 T C 7: 130,819,072 V353A probably benign Het
Cad C T 5: 31,054,983 S10L possibly damaging Het
Cdc42bpa T C 1: 180,111,787 S877P probably damaging Het
Cep152 A T 2: 125,563,632 V1660D probably benign Het
Clrn2 G T 5: 45,460,186 G133V probably damaging Het
Clstn2 T C 9: 97,456,581 I842V probably benign Het
Cpt1c C T 7: 44,965,124 A434T probably benign Het
D130052B06Rik G T 11: 33,623,477 V70L possibly damaging Het
Dlg1 T A 16: 31,793,570 V317E probably damaging Het
Dock10 T C 1: 80,536,946 E1084G possibly damaging Het
Dync2h1 A G 9: 7,157,646 V827A probably benign Het
E030030I06Rik A G 10: 22,148,933 L27P unknown Het
Ero1lb T A 13: 12,574,833 L39Q probably damaging Het
Erp27 T C 6: 136,911,611 D123G probably damaging Het
Fasn G T 11: 120,820,909 F148L probably damaging Het
Fbxl5 T C 5: 43,765,404 E218G probably damaging Het
Fbxw28 A T 9: 109,329,425 D210E probably damaging Het
Gm10653 T A 9: 62,841,514 probably benign Het
Gm17067 A G 7: 42,708,130 L316S probably benign Het
Gm29106 T C 1: 118,200,260 S561P probably damaging Het
H2afy2 T C 10: 61,747,762 T200A possibly damaging Het
Hmcn1 C A 1: 150,632,437 K3699N probably benign Het
Itch T A 2: 155,179,089 probably null Het
Itpr3 C T 17: 27,098,171 A800V probably damaging Het
Kdm2b A T 5: 122,879,587 M1052K probably damaging Het
Kdm4b T C 17: 56,396,576 M712T probably damaging Het
Kmt5b A G 19: 3,802,104 E137G probably damaging Het
Krt33a G A 11: 100,012,463 T251I probably benign Het
Lrrc4b G T 7: 44,462,330 R542L probably benign Het
Macf1 C A 4: 123,507,333 S653I probably damaging Het
Macrod2 G A 2: 142,318,447 V408M probably damaging Het
Mapkapk3 G T 9: 107,289,226 A40E possibly damaging Het
Mmp20 G A 9: 7,639,301 V157I probably benign Het
Mrps28 T C 3: 8,923,745 R18G possibly damaging Het
Msrb2 T A 2: 19,394,311 C162S probably damaging Het
Nat6 A G 9: 107,583,554 Y216C probably damaging Het
Nckap5 T G 1: 126,025,786 T1078P possibly damaging Het
Nectin3 T C 16: 46,436,400 Y91C probably benign Het
Nf2 G T 11: 4,784,566 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1209 T C 2: 88,910,036 D119G probably damaging Het
Olfr1288 T A 2: 111,478,965 Y60* probably null Het
Olfr1380 A T 11: 49,564,601 I227F possibly damaging Het
Olfr149 G A 9: 39,702,400 A123V probably damaging Het
Olfr537-ps1 A T 7: 140,538,876 M120L unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxr1 T G 15: 41,825,901 L507W probably damaging Het
Plxna2 A G 1: 194,794,427 M1184V probably benign Het
Plxna2 A T 1: 194,799,575 K1451M probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Ppp1r16b T C 2: 158,755,217 V257A possibly damaging Het
Prss56 G A 1: 87,187,557 W498* probably null Het
Ptpru A G 4: 131,771,293 F1329S probably damaging Het
Pusl1 A G 4: 155,889,463 F278S probably damaging Het
Qars A T 9: 108,513,690 L470F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rora T A 9: 69,364,452 N181K probably benign Het
Rufy3 A G 5: 88,627,255 D262G probably damaging Het
Sh3gl2 G A 4: 85,381,414 V212M probably damaging Het
Sis G A 3: 72,928,308 T907I probably benign Het
Slc38a3 A T 9: 107,652,175 I456N probably damaging Het
Slc4a8 T A 15: 100,807,339 C809S probably benign Het
Snap91 A T 9: 86,825,080 probably null Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Spry1 T C 3: 37,642,848 I80T possibly damaging Het
St8sia2 A G 7: 73,960,710 L275P possibly damaging Het
Supt7l C A 5: 31,526,987 probably null Het
Tdo2 T A 3: 81,961,440 K304N probably damaging Het
Tdrd12 A T 7: 35,485,230 Y753N probably damaging Het
Topbp1 A T 9: 103,344,953 Q1341L probably benign Het
Trim14 G T 4: 46,506,998 A406E probably benign Het
Trp63 C T 16: 25,868,214 R393W probably damaging Het
Trrap T C 5: 144,817,679 V1932A possibly damaging Het
Trrap T C 5: 144,825,914 M2399T possibly damaging Het
Unc45b A G 11: 82,913,327 N110S probably damaging Het
Usp32 G T 11: 85,025,582 H845Q probably damaging Het
Usp44 G A 10: 93,846,632 D268N probably damaging Het
Vmn1r18 T G 6: 57,390,466 R34S possibly damaging Het
Vmn2r103 T A 17: 19,794,216 Y423* probably null Het
Zbtb8b A G 4: 129,428,493 Y392H probably damaging Het
Zdhhc2 A T 8: 40,472,927 Q321L probably null Het
Zfp983 A G 17: 21,662,485 D443G probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- AATATCTTTCTAGGGACTCCTGTGTC -3'
(R):5'- TCAGGTTAACATGCCTTTATTGAGGTC -3'

Sequencing Primer
(F):5'- GACTCCTGTGTCCCTCTCAC -3'
(R):5'- CATGCCTTTATTGAGGTCAAGTTC -3'
Posted On2017-06-26