Incidental Mutation 'R6029:Wapl'
ID 480287
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 044201-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6029 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34461204 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 1054 (E1054V)
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: E1054V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: E1054V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090027
AA Change: E1048V

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: E1048V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect unknown
Transcript: ENSMUST00000151285
AA Change: E283V
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: E283V

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: E1054V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: E1054V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174559
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Meta Mutation Damage Score 0.5941 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,524,370 (GRCm39) probably null Het
Adi1 G A 12: 28,729,318 (GRCm39) probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Apob A G 12: 8,066,243 (GRCm39) E4371G probably damaging Het
Ash1l T C 3: 88,892,326 (GRCm39) Y1402H probably damaging Het
Aspm T G 1: 139,408,728 (GRCm39) C2538W possibly damaging Het
Brd10 A G 19: 29,732,367 (GRCm39) probably benign Het
Btbd16 T C 7: 130,420,802 (GRCm39) V353A probably benign Het
Cad C T 5: 31,212,327 (GRCm39) S10L possibly damaging Het
Cdc42bpa T C 1: 179,939,352 (GRCm39) S877P probably damaging Het
Cep152 A T 2: 125,405,552 (GRCm39) V1660D probably benign Het
Clrn2 G T 5: 45,617,528 (GRCm39) G133V probably damaging Het
Clstn2 T C 9: 97,338,634 (GRCm39) I842V probably benign Het
Cpt1c C T 7: 44,614,548 (GRCm39) A434T probably benign Het
D130052B06Rik G T 11: 33,573,477 (GRCm39) V70L possibly damaging Het
Dlg1 T A 16: 31,612,388 (GRCm39) V317E probably damaging Het
Dock10 T C 1: 80,514,663 (GRCm39) E1084G possibly damaging Het
Dync2h1 A G 9: 7,157,646 (GRCm39) V827A probably benign Het
E030030I06Rik A G 10: 22,024,832 (GRCm39) L27P unknown Het
Ero1b T A 13: 12,589,714 (GRCm39) L39Q probably damaging Het
Erp27 T C 6: 136,888,609 (GRCm39) D123G probably damaging Het
Fasn G T 11: 120,711,735 (GRCm39) F148L probably damaging Het
Fbxl5 T C 5: 43,922,746 (GRCm39) E218G probably damaging Het
Fbxw28 A T 9: 109,158,493 (GRCm39) D210E probably damaging Het
Gm10653 T A 9: 62,748,796 (GRCm39) probably benign Het
Gm17067 A G 7: 42,357,554 (GRCm39) L316S probably benign Het
Gm29106 T C 1: 118,127,990 (GRCm39) S561P probably damaging Het
Hmcn1 C A 1: 150,508,188 (GRCm39) K3699N probably benign Het
Itch T A 2: 155,021,009 (GRCm39) probably null Het
Itpr3 C T 17: 27,317,145 (GRCm39) A800V probably damaging Het
Kdm2b A T 5: 123,017,650 (GRCm39) M1052K probably damaging Het
Kdm4b T C 17: 56,703,576 (GRCm39) M712T probably damaging Het
Kmt5b A G 19: 3,852,104 (GRCm39) E137G probably damaging Het
Krt33a G A 11: 99,903,289 (GRCm39) T251I probably benign Het
Lrrc4b G T 7: 44,111,754 (GRCm39) R542L probably benign Het
Macf1 C A 4: 123,401,126 (GRCm39) S653I probably damaging Het
Macrod2 G A 2: 142,160,367 (GRCm39) V408M probably damaging Het
Macroh2a2 T C 10: 61,583,541 (GRCm39) T200A possibly damaging Het
Mapkapk3 G T 9: 107,166,425 (GRCm39) A40E possibly damaging Het
Mmp20 G A 9: 7,639,302 (GRCm39) V157I probably benign Het
Mrps28 T C 3: 8,988,805 (GRCm39) R18G possibly damaging Het
Msrb2 T A 2: 19,399,122 (GRCm39) C162S probably damaging Het
Naa80 A G 9: 107,460,753 (GRCm39) Y216C probably damaging Het
Nckap5 T G 1: 125,953,523 (GRCm39) T1078P possibly damaging Het
Nectin3 T C 16: 46,256,763 (GRCm39) Y91C probably benign Het
Nf2 G T 11: 4,734,566 (GRCm39) probably null Het
Or10d1b G A 9: 39,613,696 (GRCm39) A123V probably damaging Het
Or13a23-ps1 A T 7: 140,118,789 (GRCm39) M120L unknown Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2y10 A T 11: 49,455,428 (GRCm39) I227F possibly damaging Het
Or4c29 T C 2: 88,740,380 (GRCm39) D119G probably damaging Het
Or4g7 T A 2: 111,309,310 (GRCm39) Y60* probably null Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Oxr1 T G 15: 41,689,297 (GRCm39) L507W probably damaging Het
Plxna2 A T 1: 194,481,883 (GRCm39) K1451M probably damaging Het
Plxna2 A G 1: 194,476,735 (GRCm39) M1184V probably benign Het
Pofut1 G A 2: 153,101,713 (GRCm39) probably null Het
Ppp1r16b T C 2: 158,597,137 (GRCm39) V257A possibly damaging Het
Prss56 G A 1: 87,115,279 (GRCm39) W498* probably null Het
Ptpru A G 4: 131,498,604 (GRCm39) F1329S probably damaging Het
Pusl1 A G 4: 155,973,920 (GRCm39) F278S probably damaging Het
Qars1 A T 9: 108,390,889 (GRCm39) L470F probably damaging Het
Rbm8a2 T C 1: 175,806,312 (GRCm39) D55G probably benign Het
Rora T A 9: 69,271,734 (GRCm39) N181K probably benign Het
Rufy3 A G 5: 88,775,114 (GRCm39) D262G probably damaging Het
Sh3gl2 G A 4: 85,299,651 (GRCm39) V212M probably damaging Het
Sis G A 3: 72,835,641 (GRCm39) T907I probably benign Het
Slc38a3 A T 9: 107,529,374 (GRCm39) I456N probably damaging Het
Slc4a8 T A 15: 100,705,220 (GRCm39) C809S probably benign Het
Snap91 A T 9: 86,707,133 (GRCm39) probably null Het
Spaca6 A G 17: 18,051,458 (GRCm39) T45A probably benign Het
Speer1m A T 5: 11,970,680 (GRCm39) L84F probably damaging Het
Spry1 T C 3: 37,696,997 (GRCm39) I80T possibly damaging Het
St8sia2 A G 7: 73,610,458 (GRCm39) L275P possibly damaging Het
Supt7l C A 5: 31,684,331 (GRCm39) probably null Het
Tdo2 T A 3: 81,868,747 (GRCm39) K304N probably damaging Het
Tdrd12 A T 7: 35,184,655 (GRCm39) Y753N probably damaging Het
Topbp1 A T 9: 103,222,152 (GRCm39) Q1341L probably benign Het
Trim14 G T 4: 46,506,998 (GRCm39) A406E probably benign Het
Trp63 C T 16: 25,686,964 (GRCm39) R393W probably damaging Het
Trrap T C 5: 144,754,489 (GRCm39) V1932A possibly damaging Het
Trrap T C 5: 144,762,724 (GRCm39) M2399T possibly damaging Het
Unc45b A G 11: 82,804,153 (GRCm39) N110S probably damaging Het
Usp32 G T 11: 84,916,408 (GRCm39) H845Q probably damaging Het
Usp44 G A 10: 93,682,494 (GRCm39) D268N probably damaging Het
Vmn1r18 T G 6: 57,367,451 (GRCm39) R34S possibly damaging Het
Vmn2r103 T A 17: 20,014,478 (GRCm39) Y423* probably null Het
Zbtb8b A G 4: 129,322,286 (GRCm39) Y392H probably damaging Het
Zdhhc2 A T 8: 40,925,968 (GRCm39) Q321L probably null Het
Zfp983 A G 17: 21,881,401 (GRCm39) D443G probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AATATCTTTCTAGGGACTCCTGTGTC -3'
(R):5'- TCAGGTTAACATGCCTTTATTGAGGTC -3'

Sequencing Primer
(F):5'- GACTCCTGTGTCCCTCTCAC -3'
(R):5'- CATGCCTTTATTGAGGTCAAGTTC -3'
Posted On 2017-06-26