Incidental Mutation 'R6029:Trp63'
ID480290
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Nametransformation related protein 63
SynonymsTAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1
MMRRC Submission 044201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R6029 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location25683763-25892102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25868214 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 393 (R393W)
Ref Sequence ENSEMBL: ENSMUSP00000110965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115304] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115308] [ENSMUST00000115310]
Predicted Effect probably damaging
Transcript: ENSMUST00000040231
AA Change: R299W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: R299W

DomainStartEndE-ValueType
Pfam:P53 69 265 5.4e-110 PFAM
Pfam:P53_tetramer 297 338 2.4e-20 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
SAM 447 513 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065523
AA Change: R393W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: R393W

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115304
SMART Domains Protein: ENSMUSP00000110959
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 69 265 1.5e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115305
AA Change: R299W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: R299W

DomainStartEndE-ValueType
Pfam:P53 69 265 1.1e-110 PFAM
Pfam:P53_tetramer 297 338 5.5e-21 PFAM
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115306
AA Change: R295W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: R295W

DomainStartEndE-ValueType
Pfam:P53 69 265 2.7e-110 PFAM
Pfam:P53_tetramer 293 334 9.2e-21 PFAM
low complexity region 339 352 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
SAM 443 509 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115308
AA Change: R389W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: R389W

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115310
AA Change: R393W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: R393W

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,694,026 probably null Het
4933402N22Rik A T 5: 11,920,713 L84F probably damaging Het
9930021J03Rik A G 19: 29,754,967 probably benign Het
Adi1 G A 12: 28,679,319 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Apob A G 12: 8,016,243 E4371G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,480,990 C2538W possibly damaging Het
Btbd16 T C 7: 130,819,072 V353A probably benign Het
Cad C T 5: 31,054,983 S10L possibly damaging Het
Cdc42bpa T C 1: 180,111,787 S877P probably damaging Het
Cep152 A T 2: 125,563,632 V1660D probably benign Het
Clrn2 G T 5: 45,460,186 G133V probably damaging Het
Clstn2 T C 9: 97,456,581 I842V probably benign Het
Cpt1c C T 7: 44,965,124 A434T probably benign Het
D130052B06Rik G T 11: 33,623,477 V70L possibly damaging Het
Dlg1 T A 16: 31,793,570 V317E probably damaging Het
Dock10 T C 1: 80,536,946 E1084G possibly damaging Het
Dync2h1 A G 9: 7,157,646 V827A probably benign Het
E030030I06Rik A G 10: 22,148,933 L27P unknown Het
Ero1lb T A 13: 12,574,833 L39Q probably damaging Het
Erp27 T C 6: 136,911,611 D123G probably damaging Het
Fasn G T 11: 120,820,909 F148L probably damaging Het
Fbxl5 T C 5: 43,765,404 E218G probably damaging Het
Fbxw28 A T 9: 109,329,425 D210E probably damaging Het
Gm10653 T A 9: 62,841,514 probably benign Het
Gm17067 A G 7: 42,708,130 L316S probably benign Het
Gm29106 T C 1: 118,200,260 S561P probably damaging Het
H2afy2 T C 10: 61,747,762 T200A possibly damaging Het
Hmcn1 C A 1: 150,632,437 K3699N probably benign Het
Itch T A 2: 155,179,089 probably null Het
Itpr3 C T 17: 27,098,171 A800V probably damaging Het
Kdm2b A T 5: 122,879,587 M1052K probably damaging Het
Kdm4b T C 17: 56,396,576 M712T probably damaging Het
Kmt5b A G 19: 3,802,104 E137G probably damaging Het
Krt33a G A 11: 100,012,463 T251I probably benign Het
Lrrc4b G T 7: 44,462,330 R542L probably benign Het
Macf1 C A 4: 123,507,333 S653I probably damaging Het
Macrod2 G A 2: 142,318,447 V408M probably damaging Het
Mapkapk3 G T 9: 107,289,226 A40E possibly damaging Het
Mmp20 G A 9: 7,639,301 V157I probably benign Het
Mrps28 T C 3: 8,923,745 R18G possibly damaging Het
Msrb2 T A 2: 19,394,311 C162S probably damaging Het
Nat6 A G 9: 107,583,554 Y216C probably damaging Het
Nckap5 T G 1: 126,025,786 T1078P possibly damaging Het
Nectin3 T C 16: 46,436,400 Y91C probably benign Het
Nf2 G T 11: 4,784,566 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1209 T C 2: 88,910,036 D119G probably damaging Het
Olfr1288 T A 2: 111,478,965 Y60* probably null Het
Olfr1380 A T 11: 49,564,601 I227F possibly damaging Het
Olfr149 G A 9: 39,702,400 A123V probably damaging Het
Olfr537-ps1 A T 7: 140,538,876 M120L unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxr1 T G 15: 41,825,901 L507W probably damaging Het
Plxna2 A G 1: 194,794,427 M1184V probably benign Het
Plxna2 A T 1: 194,799,575 K1451M probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Ppp1r16b T C 2: 158,755,217 V257A possibly damaging Het
Prss56 G A 1: 87,187,557 W498* probably null Het
Ptpru A G 4: 131,771,293 F1329S probably damaging Het
Pusl1 A G 4: 155,889,463 F278S probably damaging Het
Qars A T 9: 108,513,690 L470F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rora T A 9: 69,364,452 N181K probably benign Het
Rufy3 A G 5: 88,627,255 D262G probably damaging Het
Sh3gl2 G A 4: 85,381,414 V212M probably damaging Het
Sis G A 3: 72,928,308 T907I probably benign Het
Slc38a3 A T 9: 107,652,175 I456N probably damaging Het
Slc4a8 T A 15: 100,807,339 C809S probably benign Het
Snap91 A T 9: 86,825,080 probably null Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Spry1 T C 3: 37,642,848 I80T possibly damaging Het
St8sia2 A G 7: 73,960,710 L275P possibly damaging Het
Supt7l C A 5: 31,526,987 probably null Het
Tdo2 T A 3: 81,961,440 K304N probably damaging Het
Tdrd12 A T 7: 35,485,230 Y753N probably damaging Het
Topbp1 A T 9: 103,344,953 Q1341L probably benign Het
Trim14 G T 4: 46,506,998 A406E probably benign Het
Trrap T C 5: 144,817,679 V1932A possibly damaging Het
Trrap T C 5: 144,825,914 M2399T possibly damaging Het
Unc45b A G 11: 82,913,327 N110S probably damaging Het
Usp32 G T 11: 85,025,582 H845Q probably damaging Het
Usp44 G A 10: 93,846,632 D268N probably damaging Het
Vmn1r18 T G 6: 57,390,466 R34S possibly damaging Het
Vmn2r103 T A 17: 19,794,216 Y423* probably null Het
Wapl A T 14: 34,739,247 E1054V possibly damaging Het
Zbtb8b A G 4: 129,428,493 Y392H probably damaging Het
Zdhhc2 A T 8: 40,472,927 Q321L probably null Het
Zfp983 A G 17: 21,662,485 D443G probably benign Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25871076 missense probably damaging 1.00
IGL01402:Trp63 APN 16 25820385 splice site probably benign
IGL01404:Trp63 APN 16 25820385 splice site probably benign
IGL01874:Trp63 APN 16 25882585 missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25865319 missense probably damaging 1.00
IGL02008:Trp63 APN 16 25862461 missense probably damaging 1.00
IGL02336:Trp63 APN 16 25820442 missense probably damaging 1.00
IGL02470:Trp63 APN 16 25820384 splice site probably benign
IGL02720:Trp63 APN 16 25863741 missense probably damaging 0.96
IGL03230:Trp63 APN 16 25889010 missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25865263 missense probably damaging 1.00
R0086:Trp63 UTSW 16 25871087 missense probably damaging 1.00
R0281:Trp63 UTSW 16 25764302 splice site probably benign
R1448:Trp63 UTSW 16 25889120 missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25889253 missense probably damaging 1.00
R1539:Trp63 UTSW 16 25884849 missense probably benign 0.02
R3922:Trp63 UTSW 16 25889009 missense probably damaging 1.00
R3977:Trp63 UTSW 16 25820740 intron probably benign
R3978:Trp63 UTSW 16 25820740 intron probably benign
R3979:Trp63 UTSW 16 25820740 intron probably benign
R4689:Trp63 UTSW 16 25865262 missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25866218 makesense probably null
R5009:Trp63 UTSW 16 25868227 missense probably damaging 0.99
R5033:Trp63 UTSW 16 25763306 missense probably damaging 0.99
R5058:Trp63 UTSW 16 25882594 missense probably damaging 1.00
R5118:Trp63 UTSW 16 25889010 missense unknown
R5354:Trp63 UTSW 16 25684355 splice site probably null
R5363:Trp63 UTSW 16 25863718 missense probably damaging 0.99
R5668:Trp63 UTSW 16 25866185 missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25763396 critical splice donor site probably null
R6170:Trp63 UTSW 16 25884853 missense probably benign 0.28
R6186:Trp63 UTSW 16 25876733 intron probably benign
R6266:Trp63 UTSW 16 25862460 missense probably damaging 0.99
R6466:Trp63 UTSW 16 25763358 missense probably damaging 1.00
R6486:Trp63 UTSW 16 25865340 missense probably damaging 0.99
R6913:Trp63 UTSW 16 25889168 missense probably damaging 1.00
R6980:Trp63 UTSW 16 25802093 missense probably benign
R7097:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7122:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7544:Trp63 UTSW 16 25802087 missense probably benign
R7690:Trp63 UTSW 16 25876733 missense unknown
R7743:Trp63 UTSW 16 25882625 missense probably benign 0.05
R7766:Trp63 UTSW 16 25868219 missense probably damaging 0.97
R7792:Trp63 UTSW 16 25868224 missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25889240 missense probably damaging 1.00
Z1088:Trp63 UTSW 16 25763313 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCACTGAGCATCATTTACATGG -3'
(R):5'- CCTAAATTCCAAAGTATTAGCGGG -3'

Sequencing Primer
(F):5'- GAGCATCATTTACATGGTACTTGGC -3'
(R):5'- TTTCAGAAGAGGGCCCTCATCAG -3'
Posted On2017-06-26