Incidental Mutation 'R6034:Malrd1'
ID 480546
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene Name MAM and LDL receptor class A domain containing 1
Synonyms Gm13364, Gm13318, Diet1
MMRRC Submission 044206-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 15531290-16260366 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15850137 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1252 (V1252E)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
AlphaFold A2AJX4
Predicted Effect possibly damaging
Transcript: ENSMUST00000146205
AA Change: V1252E

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: V1252E

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Meta Mutation Damage Score 0.0634 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,760,984 (GRCm39) G80V unknown Het
Ash1l T C 3: 88,892,326 (GRCm39) Y1402H probably damaging Het
Atad2 A T 15: 57,971,959 (GRCm39) L306Q probably damaging Het
Atp2b4 T A 1: 133,659,645 (GRCm39) probably null Het
Atp6v1c2 C A 12: 17,357,501 (GRCm39) G95V possibly damaging Het
Birc6 T A 17: 74,922,278 (GRCm39) V2192E probably damaging Het
Catsperb A G 12: 101,542,091 (GRCm39) E597G probably benign Het
Ccdc40 A G 11: 119,133,898 (GRCm39) M556V possibly damaging Het
Ccin G A 4: 43,985,354 (GRCm39) R587K probably benign Het
Cdipt T G 7: 126,577,497 (GRCm39) V81G probably damaging Het
Cert1 A C 13: 96,746,308 (GRCm39) I236L probably benign Het
Cfh T C 1: 140,090,869 (GRCm39) K40E probably damaging Het
Cps1 T A 1: 67,196,872 (GRCm39) probably null Het
Dnah7c A T 1: 46,496,418 (GRCm39) D101V probably benign Het
Fastkd3 T A 13: 68,731,729 (GRCm39) W17R probably damaging Het
H1f4 A G 13: 23,806,296 (GRCm39) L62P probably damaging Het
H2-Ob T C 17: 34,460,192 (GRCm39) V30A probably damaging Het
Hmgxb3 T A 18: 61,265,594 (GRCm39) H1128L probably damaging Het
Hspbp1 A T 7: 4,680,711 (GRCm39) I255N probably damaging Het
Imp4 A G 1: 34,482,537 (GRCm39) D91G probably damaging Het
Itprid1 T A 6: 55,944,666 (GRCm39) D462E possibly damaging Het
Kcnip4 G T 5: 48,548,283 (GRCm39) R241S possibly damaging Het
Lilra5 T C 7: 4,245,133 (GRCm39) L259P probably benign Het
Lipf T C 19: 33,942,289 (GRCm39) I73T probably benign Het
Lsm7 T C 10: 80,688,742 (GRCm39) probably null Het
Luzp2 T A 7: 54,816,972 (GRCm39) L141M probably damaging Het
Map10 T C 8: 126,399,205 (GRCm39) L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,497,866 (GRCm39) probably benign Het
Mpp2 T C 11: 101,952,460 (GRCm39) I355V possibly damaging Het
Mtrf1l T A 10: 5,773,834 (GRCm39) probably benign Het
Myo5c A T 9: 75,163,187 (GRCm39) T339S probably benign Het
Naa15 A G 3: 51,350,242 (GRCm39) D163G probably damaging Het
Oosp2 A G 19: 11,628,879 (GRCm39) F74S probably damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or4f7 T A 2: 111,644,702 (GRCm39) Y123F probably damaging Het
Pard3 C G 8: 127,791,077 (GRCm39) probably benign Het
Pcdha1 T A 18: 37,063,651 (GRCm39) I105N probably damaging Het
Pcdhgb8 A G 18: 37,895,601 (GRCm39) T224A possibly damaging Het
Phf12 A G 11: 77,908,895 (GRCm39) N325S probably benign Het
Prom1 T A 5: 44,201,750 (GRCm39) probably null Het
Raet1e A G 10: 22,057,990 (GRCm39) *252W probably null Het
Sap130 T C 18: 31,822,459 (GRCm39) V655A possibly damaging Het
Sec16b A T 1: 157,380,509 (GRCm39) K360I probably damaging Het
Sec23ip C T 7: 128,351,927 (GRCm39) T101I possibly damaging Het
Selenoo A G 15: 88,983,546 (GRCm39) K529R probably benign Het
Slc22a15 A G 3: 101,770,235 (GRCm39) F451L possibly damaging Het
St6gal2 T A 17: 55,789,982 (GRCm39) S339T probably benign Het
Stard13 A T 5: 151,018,965 (GRCm39) probably null Het
Synm A G 7: 67,384,653 (GRCm39) V561A probably damaging Het
Tc2n A T 12: 101,617,460 (GRCm39) probably null Het
Ugt2b36 T A 5: 87,229,377 (GRCm39) D236V probably damaging Het
Vmn1r65 A G 7: 6,011,868 (GRCm39) L122P probably damaging Het
Zc3h14 T C 12: 98,737,632 (GRCm39) S40P probably benign Het
Zc3hav1l C A 6: 38,272,215 (GRCm39) G185C probably damaging Het
Zfp563 G A 17: 33,323,935 (GRCm39) A177T probably damaging Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16,146,997 (GRCm39) splice site probably benign
IGL01295:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01296:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01399:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01400:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01401:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01402:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01405:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01406:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL02105:Malrd1 APN 2 16,132,674 (GRCm39) missense unknown
IGL02581:Malrd1 APN 2 16,147,123 (GRCm39) nonsense probably null
IGL03015:Malrd1 APN 2 16,047,082 (GRCm39) missense unknown
IGL03038:Malrd1 APN 2 16,132,778 (GRCm39) missense unknown
R1353:Malrd1 UTSW 2 16,132,779 (GRCm39) missense unknown
R1385:Malrd1 UTSW 2 16,047,039 (GRCm39) missense unknown
R2242:Malrd1 UTSW 2 16,106,755 (GRCm39) missense unknown
R2888:Malrd1 UTSW 2 16,079,568 (GRCm39) missense unknown
R4398:Malrd1 UTSW 2 16,155,594 (GRCm39) missense unknown
R4982:Malrd1 UTSW 2 16,046,940 (GRCm39) missense probably benign 0.29
R5148:Malrd1 UTSW 2 16,147,037 (GRCm39) missense unknown
R5195:Malrd1 UTSW 2 16,155,621 (GRCm39) missense unknown
R5828:Malrd1 UTSW 2 15,531,464 (GRCm39) missense probably benign 0.00
R5892:Malrd1 UTSW 2 15,619,078 (GRCm39) missense probably benign 0.03
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15,700,137 (GRCm39) missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16,047,078 (GRCm39) missense unknown
R6438:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R6457:Malrd1 UTSW 2 15,672,740 (GRCm39) missense probably benign 0.41
R6457:Malrd1 UTSW 2 15,531,408 (GRCm39) start gained probably benign
R6499:Malrd1 UTSW 2 15,936,500 (GRCm39) missense probably benign 0.03
R6575:Malrd1 UTSW 2 15,847,439 (GRCm39) missense probably benign 0.00
R6792:Malrd1 UTSW 2 16,155,567 (GRCm39) missense unknown
R6796:Malrd1 UTSW 2 15,874,595 (GRCm39) missense unknown
R6930:Malrd1 UTSW 2 15,802,478 (GRCm39) missense unknown
R6959:Malrd1 UTSW 2 16,222,820 (GRCm39) missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16,155,602 (GRCm39) missense unknown
R7102:Malrd1 UTSW 2 16,147,114 (GRCm39) missense unknown
R7112:Malrd1 UTSW 2 15,929,987 (GRCm39) missense unknown
R7248:Malrd1 UTSW 2 16,106,722 (GRCm39) missense unknown
R7249:Malrd1 UTSW 2 15,628,151 (GRCm39) missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16,011,529 (GRCm39) missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15,700,010 (GRCm39) missense unknown
R7399:Malrd1 UTSW 2 15,614,901 (GRCm39) missense
R7476:Malrd1 UTSW 2 16,147,115 (GRCm39) missense unknown
R7582:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R7604:Malrd1 UTSW 2 15,930,003 (GRCm39) missense unknown
R7662:Malrd1 UTSW 2 15,876,265 (GRCm39) missense unknown
R7681:Malrd1 UTSW 2 16,222,913 (GRCm39) missense unknown
R7740:Malrd1 UTSW 2 15,619,026 (GRCm39) missense not run
R7747:Malrd1 UTSW 2 16,079,646 (GRCm39) missense unknown
R7754:Malrd1 UTSW 2 15,802,610 (GRCm39) splice site probably null
R7950:Malrd1 UTSW 2 16,132,879 (GRCm39) missense unknown
R8194:Malrd1 UTSW 2 15,929,931 (GRCm39) missense unknown
R8260:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R8314:Malrd1 UTSW 2 15,757,643 (GRCm39) missense unknown
R8342:Malrd1 UTSW 2 15,638,035 (GRCm39) missense unknown
R8386:Malrd1 UTSW 2 15,701,655 (GRCm39) missense unknown
R8492:Malrd1 UTSW 2 15,614,934 (GRCm39) missense
R8728:Malrd1 UTSW 2 15,701,753 (GRCm39) nonsense probably null
R8756:Malrd1 UTSW 2 15,757,706 (GRCm39) critical splice donor site probably null
R8869:Malrd1 UTSW 2 15,570,368 (GRCm39) critical splice donor site probably null
R8888:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8895:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8902:Malrd1 UTSW 2 16,260,145 (GRCm39) nonsense probably null
R8954:Malrd1 UTSW 2 15,556,178 (GRCm39) missense
R8960:Malrd1 UTSW 2 15,570,241 (GRCm39) nonsense probably null
R9005:Malrd1 UTSW 2 15,850,140 (GRCm39) missense unknown
R9135:Malrd1 UTSW 2 15,802,516 (GRCm39) missense unknown
R9267:Malrd1 UTSW 2 16,260,077 (GRCm39) missense unknown
R9330:Malrd1 UTSW 2 16,260,089 (GRCm39) missense unknown
R9359:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9383:Malrd1 UTSW 2 15,700,012 (GRCm39) missense unknown
R9389:Malrd1 UTSW 2 15,707,967 (GRCm39) missense unknown
R9403:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9454:Malrd1 UTSW 2 15,802,537 (GRCm39) nonsense probably null
R9454:Malrd1 UTSW 2 15,757,660 (GRCm39) missense unknown
R9520:Malrd1 UTSW 2 16,079,631 (GRCm39) missense unknown
R9544:Malrd1 UTSW 2 15,640,809 (GRCm39) missense unknown
R9609:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R9667:Malrd1 UTSW 2 15,570,026 (GRCm39) critical splice acceptor site probably null
R9721:Malrd1 UTSW 2 15,701,638 (GRCm39) missense unknown
R9787:Malrd1 UTSW 2 15,625,401 (GRCm39) missense unknown
R9800:Malrd1 UTSW 2 15,847,405 (GRCm39) missense unknown
Z1176:Malrd1 UTSW 2 16,222,656 (GRCm39) missense unknown
Z1191:Malrd1 UTSW 2 16,047,037 (GRCm39) missense unknown
Predicted Primers
Posted On 2017-06-26