Incidental Mutation 'R6034:Malrd1'
ID480546
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene NameMAM and LDL receptor class A domain containing 1
SynonymsDiet1, Gm13364, Gm13318
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location15526479-16255555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15845326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1252 (V1252E)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000146205
AA Change: V1252E

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: V1252E

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Meta Mutation Damage Score 0.0634 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16142186 splice site probably benign
IGL01295:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01296:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01399:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01400:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01401:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01402:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01405:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01406:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL02105:Malrd1 APN 2 16127863 missense unknown
IGL02581:Malrd1 APN 2 16142312 nonsense probably null
IGL03015:Malrd1 APN 2 16042271 missense unknown
IGL03038:Malrd1 APN 2 16127967 missense unknown
R1353:Malrd1 UTSW 2 16127968 missense unknown
R1385:Malrd1 UTSW 2 16042228 missense unknown
R2242:Malrd1 UTSW 2 16101944 missense unknown
R2888:Malrd1 UTSW 2 16074757 missense unknown
R4398:Malrd1 UTSW 2 16150783 missense unknown
R4982:Malrd1 UTSW 2 16042129 missense probably benign 0.29
R5148:Malrd1 UTSW 2 16142226 missense unknown
R5195:Malrd1 UTSW 2 16150810 missense unknown
R5828:Malrd1 UTSW 2 15526653 missense probably benign 0.00
R5892:Malrd1 UTSW 2 15614267 missense probably benign 0.03
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15695326 missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16042267 missense unknown
R6438:Malrd1 UTSW 2 15614206 missense
R6457:Malrd1 UTSW 2 15526597 start gained probably benign
R6457:Malrd1 UTSW 2 15667929 missense probably benign 0.41
R6499:Malrd1 UTSW 2 15931689 missense probably benign 0.03
R6575:Malrd1 UTSW 2 15842628 missense probably benign 0.00
R6792:Malrd1 UTSW 2 16150756 missense unknown
R6796:Malrd1 UTSW 2 15869784 missense unknown
R6930:Malrd1 UTSW 2 15797667 missense unknown
R6959:Malrd1 UTSW 2 16218009 missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16150791 missense unknown
R7102:Malrd1 UTSW 2 16142303 missense unknown
R7112:Malrd1 UTSW 2 15925176 missense unknown
R7248:Malrd1 UTSW 2 16101911 missense unknown
R7249:Malrd1 UTSW 2 15623340 missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16006718 missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15695199 missense unknown
R7399:Malrd1 UTSW 2 15610090 missense
R7476:Malrd1 UTSW 2 16142304 missense unknown
R7582:Malrd1 UTSW 2 15695270 missense unknown
R7604:Malrd1 UTSW 2 15925192 missense unknown
R7662:Malrd1 UTSW 2 15871454 missense unknown
R7681:Malrd1 UTSW 2 16218102 missense unknown
R7740:Malrd1 UTSW 2 15614215 missense not run
R7747:Malrd1 UTSW 2 16074835 missense unknown
R7754:Malrd1 UTSW 2 15797799 splice site probably null
R7950:Malrd1 UTSW 2 16128068 missense unknown
R8194:Malrd1 UTSW 2 15925120 missense unknown
R8260:Malrd1 UTSW 2 15614206 missense
R8314:Malrd1 UTSW 2 15752832 missense unknown
R8342:Malrd1 UTSW 2 15633224 missense unknown
R8386:Malrd1 UTSW 2 15696844 missense unknown
R8492:Malrd1 UTSW 2 15610123 missense
R8728:Malrd1 UTSW 2 15696942 nonsense probably null
R8756:Malrd1 UTSW 2 15752895 critical splice donor site probably null
R8869:Malrd1 UTSW 2 15565557 critical splice donor site probably null
Z1176:Malrd1 UTSW 2 16217845 missense unknown
Z1191:Malrd1 UTSW 2 16042226 missense unknown
Predicted Primers
Posted On2017-06-26