Incidental Mutation 'R6034:Hspbp1'
ID480558
Institutional Source Beutler Lab
Gene Symbol Hspbp1
Ensembl Gene ENSMUSG00000063802
Gene NameHSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4660521-4685068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4677712 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 255 (I255N)
Ref Sequence ENSEMBL: ENSMUSP00000146248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079970] [ENSMUST00000205952] [ENSMUST00000206306] [ENSMUST00000206946]
Predicted Effect probably damaging
Transcript: ENSMUST00000079970
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078886
Gene: ENSMUSG00000063802
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
Pfam:Fes1 43 138 2.5e-12 PFAM
SCOP:d1ee4a_ 150 302 2e-12 SMART
Blast:ARM 216 256 3e-11 BLAST
Blast:ARM 259 299 4e-13 BLAST
low complexity region 306 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205952
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206306
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206946
AA Change: I255N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5483 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show male infertility with an arrest of male meiosis, increased male germ cell apoptosis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Hspbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hspbp1 APN 7 4664751 missense probably damaging 0.97
IGL02072:Hspbp1 APN 7 4677721 missense probably damaging 1.00
IGL02548:Hspbp1 APN 7 4681841 splice site probably benign
IGL02573:Hspbp1 APN 7 4677853 missense probably damaging 1.00
IGL03177:Hspbp1 APN 7 4664701 critical splice donor site probably null
IGL03181:Hspbp1 APN 7 4684364 missense probably damaging 1.00
R0568:Hspbp1 UTSW 7 4684432 nonsense probably null
R0670:Hspbp1 UTSW 7 4677736 missense probably damaging 1.00
R3013:Hspbp1 UTSW 7 4663484 missense probably benign 0.18
R3729:Hspbp1 UTSW 7 4677809 missense probably damaging 1.00
R3934:Hspbp1 UTSW 7 4664595 missense probably benign 0.41
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6728:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6797:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6930:Hspbp1 UTSW 7 4684607 missense probably benign
R6992:Hspbp1 UTSW 7 4664715 missense probably benign 0.23
R7459:Hspbp1 UTSW 7 4684578 missense probably benign 0.00
R7525:Hspbp1 UTSW 7 4663436 missense probably damaging 1.00
R7608:Hspbp1 UTSW 7 4660822 missense possibly damaging 0.73
R7962:Hspbp1 UTSW 7 4681842 critical splice donor site probably null
Predicted Primers
Posted On2017-06-26