Incidental Mutation 'R6034:Map10'
ID 480564
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Name microtubule-associated protein 10
Synonyms 4933403G14Rik
MMRRC Submission 044206-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 125669818-125673359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125672466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 866 (L866P)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
AlphaFold Q8BJS7
Predicted Effect probably damaging
Transcript: ENSMUST00000053078
AA Change: L866P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: L866P

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 (GRCm38) G80V unknown Het
Ash1l T C 3: 88,985,019 (GRCm38) Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 (GRCm38) L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 (GRCm38) probably null Het
Atp6v1c2 C A 12: 17,307,500 (GRCm38) G95V possibly damaging Het
Birc6 T A 17: 74,615,283 (GRCm38) V2192E probably damaging Het
Catsperb A G 12: 101,575,832 (GRCm38) E597G probably benign Het
Ccdc40 A G 11: 119,243,072 (GRCm38) M556V possibly damaging Het
Ccin G A 4: 43,985,354 (GRCm38) R587K probably benign Het
Cdipt T G 7: 126,978,325 (GRCm38) V81G probably damaging Het
Cert1 A C 13: 96,609,800 (GRCm38) I236L probably benign Het
Cfh T C 1: 140,163,131 (GRCm38) K40E probably damaging Het
Cps1 T A 1: 67,157,713 (GRCm38) probably null Het
Dnah7c A T 1: 46,457,258 (GRCm38) D101V probably benign Het
Fastkd3 T A 13: 68,583,610 (GRCm38) W17R probably damaging Het
H1f4 A G 13: 23,622,313 (GRCm38) L62P probably damaging Het
H2-Ob T C 17: 34,241,218 (GRCm38) V30A probably damaging Het
Hmgxb3 T A 18: 61,132,522 (GRCm38) H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 (GRCm38) I255N probably damaging Het
Imp4 A G 1: 34,443,456 (GRCm38) D91G probably damaging Het
Itprid1 T A 6: 55,967,681 (GRCm38) D462E possibly damaging Het
Kcnip4 G T 5: 48,390,941 (GRCm38) R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 (GRCm38) L259P probably benign Het
Lipf T C 19: 33,964,889 (GRCm38) I73T probably benign Het
Lsm7 T C 10: 80,852,908 (GRCm38) probably null Het
Luzp2 T A 7: 55,167,224 (GRCm38) L141M probably damaging Het
Malrd1 T A 2: 15,845,326 (GRCm38) V1252E possibly damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 (GRCm38) probably benign Het
Mpp2 T C 11: 102,061,634 (GRCm38) I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 (GRCm38) probably benign Het
Myo5c A T 9: 75,255,905 (GRCm38) T339S probably benign Het
Naa15 A G 3: 51,442,821 (GRCm38) D163G probably damaging Het
Oosp2 A G 19: 11,651,515 (GRCm38) F74S probably damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,395,654 (GRCm38) probably null Het
Or4f7 T A 2: 111,814,357 (GRCm38) Y123F probably damaging Het
Pard3 C G 8: 127,064,327 (GRCm38) probably benign Het
Pcdha1 T A 18: 36,930,598 (GRCm38) I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 (GRCm38) T224A possibly damaging Het
Phf12 A G 11: 78,018,069 (GRCm38) N325S probably benign Het
Prom1 T A 5: 44,044,408 (GRCm38) probably null Het
Raet1e A G 10: 22,182,091 (GRCm38) *252W probably null Het
Sap130 T C 18: 31,689,406 (GRCm38) V655A possibly damaging Het
Sec16b A T 1: 157,552,939 (GRCm38) K360I probably damaging Het
Sec23ip C T 7: 128,750,203 (GRCm38) T101I possibly damaging Het
Selenoo A G 15: 89,099,343 (GRCm38) K529R probably benign Het
Slc22a15 A G 3: 101,862,919 (GRCm38) F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 (GRCm38) S339T probably benign Het
Stard13 A T 5: 151,095,500 (GRCm38) probably null Het
Synm A G 7: 67,734,905 (GRCm38) V561A probably damaging Het
Tc2n A T 12: 101,651,201 (GRCm38) probably null Het
Ugt2b36 T A 5: 87,081,518 (GRCm38) D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 (GRCm38) L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 (GRCm38) S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 (GRCm38) G185C probably damaging Het
Zfp563 G A 17: 33,104,961 (GRCm38) A177T probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 125,671,932 (GRCm38) missense probably benign 0.00
IGL01567:Map10 APN 8 125,671,493 (GRCm38) missense probably benign 0.32
IGL02566:Map10 APN 8 125,671,755 (GRCm38) missense probably benign
IGL03088:Map10 APN 8 125,671,070 (GRCm38) missense probably benign 0.14
debauched UTSW 8 125,671,245 (GRCm38) missense probably damaging 1.00
R1083:Map10 UTSW 8 125,670,439 (GRCm38) nonsense probably null
R1543:Map10 UTSW 8 125,670,872 (GRCm38) missense probably benign 0.00
R3155:Map10 UTSW 8 125,671,574 (GRCm38) missense possibly damaging 0.79
R4076:Map10 UTSW 8 125,671,845 (GRCm38) missense probably benign 0.23
R4559:Map10 UTSW 8 125,671,814 (GRCm38) missense probably benign
R4856:Map10 UTSW 8 125,670,692 (GRCm38) missense probably damaging 1.00
R4886:Map10 UTSW 8 125,670,692 (GRCm38) missense probably damaging 1.00
R5412:Map10 UTSW 8 125,670,985 (GRCm38) missense probably damaging 1.00
R6034:Map10 UTSW 8 125,672,466 (GRCm38) missense probably damaging 1.00
R6150:Map10 UTSW 8 125,671,589 (GRCm38) missense probably damaging 0.96
R6351:Map10 UTSW 8 125,671,245 (GRCm38) missense probably damaging 1.00
R6466:Map10 UTSW 8 125,672,384 (GRCm38) nonsense probably null
R6544:Map10 UTSW 8 125,671,374 (GRCm38) missense probably benign 0.00
R6557:Map10 UTSW 8 125,670,252 (GRCm38) missense probably damaging 0.98
R6821:Map10 UTSW 8 125,670,399 (GRCm38) missense probably benign 0.01
R7096:Map10 UTSW 8 125,671,923 (GRCm38) missense probably damaging 0.99
R7128:Map10 UTSW 8 125,671,853 (GRCm38) missense probably benign
R7177:Map10 UTSW 8 125,671,845 (GRCm38) missense probably benign 0.23
R7237:Map10 UTSW 8 125,671,224 (GRCm38) missense probably benign 0.03
R7814:Map10 UTSW 8 125,671,611 (GRCm38) missense probably benign 0.14
R7819:Map10 UTSW 8 125,670,521 (GRCm38) frame shift probably null
R8202:Map10 UTSW 8 125,670,908 (GRCm38) missense possibly damaging 0.95
R8812:Map10 UTSW 8 125,669,925 (GRCm38) missense probably damaging 0.99
R8859:Map10 UTSW 8 125,670,552 (GRCm38) missense probably benign 0.04
R8947:Map10 UTSW 8 125,671,100 (GRCm38) missense probably benign 0.06
R9178:Map10 UTSW 8 125,670,910 (GRCm38) missense probably damaging 0.98
R9698:Map10 UTSW 8 125,671,984 (GRCm38) missense probably benign 0.16
Z1088:Map10 UTSW 8 125,671,931 (GRCm38) frame shift probably null
Z1177:Map10 UTSW 8 125,670,070 (GRCm38) missense probably damaging 1.00
Predicted Primers
Posted On 2017-06-26