Incidental Mutation 'R6034:Ccdc40'
ID480570
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Namecoiled-coil domain containing 40
SynonymsB930008I02Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R6034 (G1)
Quality Score191.009
Status Not validated
Chromosome11
Chromosomal Location119228572-119265236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119243072 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 556 (M556V)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035935] [ENSMUST00000053440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035935
AA Change: M556V

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: M556V

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000053440
AA Change: M626V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963
AA Change: M626V

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143066
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119242719 missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119243085 missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119231971 unclassified probably null
IGL02640:Ccdc40 APN 11 119238078 missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119242510 missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119263201 missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119242451 missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119242804 missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119231803 missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119263189 missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119259904 missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119263075 unclassified probably null
R2106:Ccdc40 UTSW 11 119264297 missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119263117 missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119234779 missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119264281 missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119242509 missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119231532 missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119231506 missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119253621 missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119231788 missense probably benign
R5237:Ccdc40 UTSW 11 119259976 missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119237927 missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119231572 missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119246080 critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119242746 missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119253403 missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119251012 missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119231978 missense probably benign
R6166:Ccdc40 UTSW 11 119232001 missense probably benign
R6336:Ccdc40 UTSW 11 119231993 missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119242734 missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119242739 missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119231786 missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119264444 missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119263148 missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119232221 missense possibly damaging 0.73
S24628:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
Predicted Primers
Posted On2017-06-26