Incidental Mutation 'R6034:Selenoo'
ID480578
Institutional Source Beutler Lab
Gene Symbol Selenoo
Ensembl Gene ENSMUSG00000035757
Gene Nameselenoprotein O
SynonymsSelo, 1300018J18Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89089084-89100340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89099343 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 529 (K529R)
Ref Sequence ENSEMBL: ENSMUSP00000081020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
AA Change: K529R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757
AA Change: K529R

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130700
SMART Domains Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 80 241 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163290
SMART Domains Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 91 288 2.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164717
Predicted Effect probably benign
Transcript: ENSMUST00000166480
SMART Domains Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 2 123 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168256
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169208
Predicted Effect probably benign
Transcript: ENSMUST00000170877
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a selenoprotein that is localized to the mitochondria. It is the largest mammalian selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The exact function of this selenoprotein is not known, but it is thought to have redox activity. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Selenoo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Selenoo APN 15 89095672 missense probably damaging 1.00
IGL01922:Selenoo APN 15 89099649 missense probably benign 0.06
IGL02103:Selenoo APN 15 89099970 missense probably damaging 1.00
R0655:Selenoo UTSW 15 89095655 missense probably damaging 1.00
R0960:Selenoo UTSW 15 89096754 missense probably benign 0.08
R1610:Selenoo UTSW 15 89099916 missense probably benign
R2152:Selenoo UTSW 15 89099282 missense probably benign 0.01
R4177:Selenoo UTSW 15 89099459 unclassified probably benign
R4588:Selenoo UTSW 15 89096718 missense probably benign 0.01
R4622:Selenoo UTSW 15 89095707 nonsense probably null
R4731:Selenoo UTSW 15 89099328 missense probably benign 0.00
R4926:Selenoo UTSW 15 89099678 missense probably damaging 0.98
R4934:Selenoo UTSW 15 89098767 missense probably damaging 0.98
R4999:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5000:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5033:Selenoo UTSW 15 89092766 missense probably damaging 1.00
R5120:Selenoo UTSW 15 89094305 missense possibly damaging 0.79
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R7238:Selenoo UTSW 15 89089224 missense probably benign 0.15
R7287:Selenoo UTSW 15 89098700 missense probably benign 0.01
R7378:Selenoo UTSW 15 89089478 missense probably benign 0.07
R7818:Selenoo UTSW 15 89096816 missense probably damaging 1.00
Predicted Primers
Posted On2017-06-26