Incidental Mutation 'R5997:Dnah14'
ID 480593
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 044176-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5997 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181597670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3640 (N3640D)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160345
SMART Domains Protein: ENSMUSP00000124817
Gene: ENSMUSG00000047369

DomainStartEndE-ValueType
Pfam:MT 46 381 2.1e-41 PFAM
Pfam:AAA_9 401 524 8.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: N3640D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A T 5: 124,227,878 (GRCm39) V121E possibly damaging Het
Acsbg3 A T 17: 57,183,373 (GRCm39) D38V probably benign Het
Adamts20 T A 15: 94,277,628 (GRCm39) Y278F probably damaging Het
Adcy7 A T 8: 89,053,020 (GRCm39) D972V probably benign Het
Adgrf3 C A 5: 30,403,360 (GRCm39) probably null Het
Ahdc1 G T 4: 132,791,206 (GRCm39) G816C probably benign Het
Aifm3 A G 16: 17,319,994 (GRCm39) K283E probably benign Het
Akap6 T C 12: 52,984,016 (GRCm39) probably null Het
Ank1 T C 8: 23,589,678 (GRCm39) L593P probably damaging Het
Apol11b T A 15: 77,519,697 (GRCm39) T128S probably benign Het
C1qtnf7 C A 5: 43,773,427 (GRCm39) T235K probably damaging Het
Camk2a A T 18: 61,111,029 (GRCm39) I73F probably damaging Het
Ccdc121rt3 C T 5: 112,502,874 (GRCm39) V277M possibly damaging Het
Cd109 G T 9: 78,612,344 (GRCm39) V1244F possibly damaging Het
Cep164 A G 9: 45,680,761 (GRCm39) L1240S possibly damaging Het
Cnga1 T A 5: 72,761,918 (GRCm39) D532V probably damaging Het
Cyp4a14 A T 4: 115,353,297 (GRCm39) L5* probably null Het
Cyp4a30b A T 4: 115,316,588 (GRCm39) K405* probably null Het
Dchs1 T C 7: 105,403,302 (GRCm39) D3080G probably benign Het
Ddx1 T C 12: 13,287,800 (GRCm39) D168G probably damaging Het
Dhx57 T G 17: 80,553,235 (GRCm39) K1231Q probably damaging Het
Dock4 T A 12: 40,805,833 (GRCm39) L935Q probably damaging Het
Dus2 A T 8: 106,772,698 (GRCm39) R269S probably benign Het
E230025N22Rik G A 18: 36,822,161 (GRCm39) R201C possibly damaging Het
Erbb3 G A 10: 128,419,054 (GRCm39) T269M probably damaging Het
Fbxo43 T C 15: 36,162,239 (GRCm39) R323G probably damaging Het
Fktn A G 4: 53,735,061 (GRCm39) H233R probably benign Het
Ftsj3 A T 11: 106,143,077 (GRCm39) D412E probably damaging Het
Fzd7 A T 1: 59,523,703 (GRCm39) M529L probably benign Het
Fzr1 T A 10: 81,206,660 (GRCm39) probably null Het
Ganc T G 2: 120,261,086 (GRCm39) V257G possibly damaging Het
Garin1a T A 6: 29,290,423 (GRCm39) L267* probably null Het
Gm4131 T C 14: 62,702,207 (GRCm39) K254E probably damaging Het
Gm7347 G T 5: 26,262,247 (GRCm39) Y91* probably null Het
Gm9857 G A 3: 108,847,481 (GRCm39) probably benign Het
Grpel1 T C 5: 36,622,592 (GRCm39) S19P probably benign Het
Gtf3c4 T C 2: 28,723,723 (GRCm39) K670E possibly damaging Het
H2bc7 G A 13: 23,758,277 (GRCm39) probably benign Het
Hmcn1 G T 1: 150,579,924 (GRCm39) Q1938K possibly damaging Het
Hnrnpk T C 13: 58,546,971 (GRCm39) D71G probably damaging Het
Hspa4l G A 3: 40,722,411 (GRCm39) R311H probably damaging Het
Igkv3-5 T A 6: 70,640,688 (GRCm39) F56L probably benign Het
Igkv6-20 T A 6: 70,312,898 (GRCm39) T92S possibly damaging Het
Krt8 C T 15: 101,909,029 (GRCm39) V200I possibly damaging Het
Lamb2 A T 9: 108,357,587 (GRCm39) T66S possibly damaging Het
Lamp3 A G 16: 19,519,778 (GRCm39) L135S probably benign Het
Lrguk A G 6: 34,106,078 (GRCm39) Y701C probably damaging Het
Mcc G T 18: 44,582,388 (GRCm39) L588M probably damaging Het
Mcidas T A 13: 113,135,120 (GRCm39) L234Q probably damaging Het
Mtmr14 T A 6: 113,257,575 (GRCm39) L208Q probably damaging Het
Myof A G 19: 37,893,747 (GRCm39) F1139L possibly damaging Het
Nlrp14 C A 7: 106,781,703 (GRCm39) T300K probably benign Het
Or2d36 A T 7: 106,746,535 (GRCm39) E4V possibly damaging Het
Or2m13 T A 16: 19,226,694 (GRCm39) H24L probably benign Het
Or5b118 A G 19: 13,448,870 (GRCm39) I179V probably benign Het
Or8b41 A T 9: 38,055,097 (GRCm39) Y217F probably damaging Het
Orc2 A G 1: 58,511,547 (GRCm39) I354T probably damaging Het
Pard3b G T 1: 62,115,568 (GRCm39) S140I probably damaging Het
Pcgf5 A G 19: 36,412,003 (GRCm39) D49G probably benign Het
Pcsk6 T C 7: 65,609,041 (GRCm39) F388S probably damaging Het
Prokr2 A C 2: 132,223,362 (GRCm39) I60S probably damaging Het
Rab33b A G 3: 51,391,900 (GRCm39) T50A possibly damaging Het
Rbms3 T C 9: 116,548,457 (GRCm39) D61G probably damaging Het
Rhcg T A 7: 79,250,262 (GRCm39) K274* probably null Het
Rnf112 C T 11: 61,341,848 (GRCm39) V319M possibly damaging Het
Rnf44 A T 13: 54,830,613 (GRCm39) S265T possibly damaging Het
Sf3a3 A G 4: 124,615,851 (GRCm39) D168G probably damaging Het
Sik2 A G 9: 50,806,642 (GRCm39) probably null Het
Slco1a5 T A 6: 142,198,839 (GRCm39) L275F probably benign Het
Smtnl1 T C 2: 84,645,722 (GRCm39) H383R probably damaging Het
Spns3 T G 11: 72,429,904 (GRCm39) T175P probably damaging Het
Togaram1 A G 12: 65,042,312 (GRCm39) T1174A probably benign Het
Tradd C T 8: 105,987,277 (GRCm39) E10K possibly damaging Het
Ttc7b A T 12: 100,339,819 (GRCm39) Y579N probably damaging Het
Uncx G A 5: 139,533,344 (GRCm39) G470R probably damaging Het
Vav3 T A 3: 109,408,777 (GRCm39) M177K probably damaging Het
Wfs1 A T 5: 37,125,094 (GRCm39) I599N probably damaging Het
Zfp454 G A 11: 50,764,449 (GRCm39) H217Y probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGCGCTATTCAATGAGC -3'
(R):5'- TCCGCTTTACATTAAGACCACC -3'

Sequencing Primer
(F):5'- CGCTATTCAATGAGCATAAACTCTGC -3'
(R):5'- TTCATGAGATCTAGGCTAGCCCAG -3'
Posted On 2017-06-26