Incidental Mutation 'R5997:Lrguk'
ID 480616
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 044176-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5997 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34106078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 701 (Y701C)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: Y701C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: Y701C

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Meta Mutation Damage Score 0.1547 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A T 5: 124,227,878 (GRCm39) V121E possibly damaging Het
Acsbg3 A T 17: 57,183,373 (GRCm39) D38V probably benign Het
Adamts20 T A 15: 94,277,628 (GRCm39) Y278F probably damaging Het
Adcy7 A T 8: 89,053,020 (GRCm39) D972V probably benign Het
Adgrf3 C A 5: 30,403,360 (GRCm39) probably null Het
Ahdc1 G T 4: 132,791,206 (GRCm39) G816C probably benign Het
Aifm3 A G 16: 17,319,994 (GRCm39) K283E probably benign Het
Akap6 T C 12: 52,984,016 (GRCm39) probably null Het
Ank1 T C 8: 23,589,678 (GRCm39) L593P probably damaging Het
Apol11b T A 15: 77,519,697 (GRCm39) T128S probably benign Het
C1qtnf7 C A 5: 43,773,427 (GRCm39) T235K probably damaging Het
Camk2a A T 18: 61,111,029 (GRCm39) I73F probably damaging Het
Ccdc121rt3 C T 5: 112,502,874 (GRCm39) V277M possibly damaging Het
Cd109 G T 9: 78,612,344 (GRCm39) V1244F possibly damaging Het
Cep164 A G 9: 45,680,761 (GRCm39) L1240S possibly damaging Het
Cnga1 T A 5: 72,761,918 (GRCm39) D532V probably damaging Het
Cyp4a14 A T 4: 115,353,297 (GRCm39) L5* probably null Het
Cyp4a30b A T 4: 115,316,588 (GRCm39) K405* probably null Het
Dchs1 T C 7: 105,403,302 (GRCm39) D3080G probably benign Het
Ddx1 T C 12: 13,287,800 (GRCm39) D168G probably damaging Het
Dhx57 T G 17: 80,553,235 (GRCm39) K1231Q probably damaging Het
Dnah14 A G 1: 181,597,670 (GRCm39) N3640D probably benign Het
Dock4 T A 12: 40,805,833 (GRCm39) L935Q probably damaging Het
Dus2 A T 8: 106,772,698 (GRCm39) R269S probably benign Het
E230025N22Rik G A 18: 36,822,161 (GRCm39) R201C possibly damaging Het
Erbb3 G A 10: 128,419,054 (GRCm39) T269M probably damaging Het
Fbxo43 T C 15: 36,162,239 (GRCm39) R323G probably damaging Het
Fktn A G 4: 53,735,061 (GRCm39) H233R probably benign Het
Ftsj3 A T 11: 106,143,077 (GRCm39) D412E probably damaging Het
Fzd7 A T 1: 59,523,703 (GRCm39) M529L probably benign Het
Fzr1 T A 10: 81,206,660 (GRCm39) probably null Het
Ganc T G 2: 120,261,086 (GRCm39) V257G possibly damaging Het
Garin1a T A 6: 29,290,423 (GRCm39) L267* probably null Het
Gm4131 T C 14: 62,702,207 (GRCm39) K254E probably damaging Het
Gm7347 G T 5: 26,262,247 (GRCm39) Y91* probably null Het
Gm9857 G A 3: 108,847,481 (GRCm39) probably benign Het
Grpel1 T C 5: 36,622,592 (GRCm39) S19P probably benign Het
Gtf3c4 T C 2: 28,723,723 (GRCm39) K670E possibly damaging Het
H2bc7 G A 13: 23,758,277 (GRCm39) probably benign Het
Hmcn1 G T 1: 150,579,924 (GRCm39) Q1938K possibly damaging Het
Hnrnpk T C 13: 58,546,971 (GRCm39) D71G probably damaging Het
Hspa4l G A 3: 40,722,411 (GRCm39) R311H probably damaging Het
Igkv3-5 T A 6: 70,640,688 (GRCm39) F56L probably benign Het
Igkv6-20 T A 6: 70,312,898 (GRCm39) T92S possibly damaging Het
Krt8 C T 15: 101,909,029 (GRCm39) V200I possibly damaging Het
Lamb2 A T 9: 108,357,587 (GRCm39) T66S possibly damaging Het
Lamp3 A G 16: 19,519,778 (GRCm39) L135S probably benign Het
Mcc G T 18: 44,582,388 (GRCm39) L588M probably damaging Het
Mcidas T A 13: 113,135,120 (GRCm39) L234Q probably damaging Het
Mtmr14 T A 6: 113,257,575 (GRCm39) L208Q probably damaging Het
Myof A G 19: 37,893,747 (GRCm39) F1139L possibly damaging Het
Nlrp14 C A 7: 106,781,703 (GRCm39) T300K probably benign Het
Or2d36 A T 7: 106,746,535 (GRCm39) E4V possibly damaging Het
Or2m13 T A 16: 19,226,694 (GRCm39) H24L probably benign Het
Or5b118 A G 19: 13,448,870 (GRCm39) I179V probably benign Het
Or8b41 A T 9: 38,055,097 (GRCm39) Y217F probably damaging Het
Orc2 A G 1: 58,511,547 (GRCm39) I354T probably damaging Het
Pard3b G T 1: 62,115,568 (GRCm39) S140I probably damaging Het
Pcgf5 A G 19: 36,412,003 (GRCm39) D49G probably benign Het
Pcsk6 T C 7: 65,609,041 (GRCm39) F388S probably damaging Het
Prokr2 A C 2: 132,223,362 (GRCm39) I60S probably damaging Het
Rab33b A G 3: 51,391,900 (GRCm39) T50A possibly damaging Het
Rbms3 T C 9: 116,548,457 (GRCm39) D61G probably damaging Het
Rhcg T A 7: 79,250,262 (GRCm39) K274* probably null Het
Rnf112 C T 11: 61,341,848 (GRCm39) V319M possibly damaging Het
Rnf44 A T 13: 54,830,613 (GRCm39) S265T possibly damaging Het
Sf3a3 A G 4: 124,615,851 (GRCm39) D168G probably damaging Het
Sik2 A G 9: 50,806,642 (GRCm39) probably null Het
Slco1a5 T A 6: 142,198,839 (GRCm39) L275F probably benign Het
Smtnl1 T C 2: 84,645,722 (GRCm39) H383R probably damaging Het
Spns3 T G 11: 72,429,904 (GRCm39) T175P probably damaging Het
Togaram1 A G 12: 65,042,312 (GRCm39) T1174A probably benign Het
Tradd C T 8: 105,987,277 (GRCm39) E10K possibly damaging Het
Ttc7b A T 12: 100,339,819 (GRCm39) Y579N probably damaging Het
Uncx G A 5: 139,533,344 (GRCm39) G470R probably damaging Het
Vav3 T A 3: 109,408,777 (GRCm39) M177K probably damaging Het
Wfs1 A T 5: 37,125,094 (GRCm39) I599N probably damaging Het
Zfp454 G A 11: 50,764,449 (GRCm39) H217Y probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTTAGGCTGCAATGACGCC -3'
(R):5'- ACAGATCTTAGTGACAGGCGGG -3'

Sequencing Primer
(F):5'- ATGACGCCGCCATGCAAG -3'
(R):5'- GCACAGTTTCAGAATTTCTCCAAAGC -3'
Posted On 2017-06-26