Incidental Mutation 'R5997:Lrguk'
ID 480616
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5997 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34129143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 701 (Y701C)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: Y701C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: Y701C

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Meta Mutation Damage Score 0.1547 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTTAGGCTGCAATGACGCC -3'
(R):5'- ACAGATCTTAGTGACAGGCGGG -3'

Sequencing Primer
(F):5'- ATGACGCCGCCATGCAAG -3'
(R):5'- GCACAGTTTCAGAATTTCTCCAAAGC -3'
Posted On 2017-06-26