Incidental Mutation 'R5997:Pcsk6'
ID480621
Institutional Source Beutler Lab
Gene Symbol Pcsk6
Ensembl Gene ENSMUSG00000030513
Gene Nameproprotein convertase subtilisin/kexin type 6
SynonymsPACE4, SPC4
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R5997 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location65861734-66050386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65959293 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 388 (F388S)
Ref Sequence ENSEMBL: ENSMUSP00000095992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176209]
Predicted Effect probably damaging
Transcript: ENSMUST00000055576
AA Change: F388S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513
AA Change: F388S

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
Pfam:S8_pro-domain 65 141 3.1e-29 PFAM
Pfam:Peptidase_S8 186 469 5.2e-49 PFAM
Pfam:P_proprotein 529 619 9.7e-37 PFAM
FU 682 729 5.87e-11 SMART
EGF_like 688 737 5.03e1 SMART
FU 733 780 4.35e-14 SMART
EGF_like 738 771 3.57e1 SMART
FU 784 828 2.08e-11 SMART
EGF 789 819 2.48e1 SMART
FU 832 877 9.4e-10 SMART
EGF_like 837 868 6.28e1 SMART
FU 885 933 8.58e-4 SMART
EGF 890 920 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098391
AA Change: F388S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513
AA Change: F388S

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
PDB:1KN6|A 62 129 2e-6 PDB
low complexity region 131 144 N/A INTRINSIC
Pfam:Peptidase_S8 190 478 1.1e-58 PFAM
Pfam:P_proprotein 529 619 4.5e-37 PFAM
FU 669 716 3.87e-11 SMART
EGF_like 675 724 5.03e1 SMART
FU 720 767 4.35e-14 SMART
EGF_like 725 758 3.57e1 SMART
FU 771 815 2.08e-11 SMART
EGF 776 806 2.48e1 SMART
FU 819 864 9.4e-10 SMART
EGF_like 824 855 6.28e1 SMART
FU 872 920 8.58e-4 SMART
EGF 877 907 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176209
AA Change: F301S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513
AA Change: F301S

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:Peptidase_S8 103 372 6.5e-50 PFAM
Pfam:P_proprotein 368 458 6.2e-37 PFAM
FU 521 568 5.87e-11 SMART
EGF_like 527 576 5.03e1 SMART
FU 572 619 4.35e-14 SMART
EGF_like 577 610 3.57e1 SMART
FU 623 667 2.08e-11 SMART
EGF 628 658 2.48e1 SMART
FU 671 716 9.4e-10 SMART
EGF_like 676 707 6.28e1 SMART
FU 724 772 8.58e-4 SMART
EGF 729 759 1.69e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177369
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Pcsk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pcsk6 APN 7 65927820 missense probably damaging 1.00
IGL01609:Pcsk6 APN 7 66035273 splice site probably null
IGL01986:Pcsk6 APN 7 65927877 missense probably damaging 1.00
IGL02592:Pcsk6 APN 7 65969028 missense probably damaging 1.00
IGL02720:Pcsk6 APN 7 65980247 nonsense probably null
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0119:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0299:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0415:Pcsk6 UTSW 7 66033874 missense probably damaging 1.00
R0496:Pcsk6 UTSW 7 65927249 missense probably benign 0.00
R0518:Pcsk6 UTSW 7 65980167 missense possibly damaging 0.64
R0748:Pcsk6 UTSW 7 66038968 unclassified probably benign
R1456:Pcsk6 UTSW 7 66043535 missense possibly damaging 0.87
R1613:Pcsk6 UTSW 7 65910311 splice site probably benign
R1680:Pcsk6 UTSW 7 66035250 missense probably benign 0.14
R1682:Pcsk6 UTSW 7 65910228 missense probably damaging 1.00
R1987:Pcsk6 UTSW 7 65927287 missense possibly damaging 0.60
R4191:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4193:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4577:Pcsk6 UTSW 7 65959266 nonsense probably null
R4592:Pcsk6 UTSW 7 65931732 missense possibly damaging 0.54
R4687:Pcsk6 UTSW 7 65983753 missense probably damaging 1.00
R4697:Pcsk6 UTSW 7 65959241 missense probably damaging 1.00
R4778:Pcsk6 UTSW 7 65959145 missense probably damaging 1.00
R5065:Pcsk6 UTSW 7 65910299 missense possibly damaging 0.84
R5218:Pcsk6 UTSW 7 66025288 missense probably benign 0.01
R5356:Pcsk6 UTSW 7 65970592 missense probably damaging 1.00
R5427:Pcsk6 UTSW 7 66033899 missense probably benign 0.01
R5589:Pcsk6 UTSW 7 65929185 critical splice donor site probably null
R5637:Pcsk6 UTSW 7 65968997 missense probably damaging 1.00
R5888:Pcsk6 UTSW 7 66043624 missense probably null
R5958:Pcsk6 UTSW 7 66043611 missense probably damaging 1.00
R6191:Pcsk6 UTSW 7 65929127 missense probably benign 0.19
R6274:Pcsk6 UTSW 7 66033844 missense probably damaging 1.00
R6374:Pcsk6 UTSW 7 65980155 missense possibly damaging 0.80
R6393:Pcsk6 UTSW 7 65969014 missense probably damaging 1.00
R6730:Pcsk6 UTSW 7 65980248 missense probably damaging 1.00
R7205:Pcsk6 UTSW 7 66025408 critical splice donor site probably null
R7493:Pcsk6 UTSW 7 66043566 missense possibly damaging 0.53
R7570:Pcsk6 UTSW 7 66033898 missense probably benign 0.03
R7731:Pcsk6 UTSW 7 66033893 missense probably benign 0.00
R7779:Pcsk6 UTSW 7 66025404 missense probably benign 0.03
R8042:Pcsk6 UTSW 7 65927935 missense possibly damaging 0.87
Z1177:Pcsk6 UTSW 7 65959113 missense probably damaging 1.00
Z1177:Pcsk6 UTSW 7 66033811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGCTTCCATGTAGGGTCG -3'
(R):5'- GGGCACAGATGAGTCAAACATC -3'

Sequencing Primer
(F):5'- TTCCATGTAGGGTCGCCAAG -3'
(R):5'- TAAAGTCTGAGGCAGGCT -3'
Posted On2017-06-26