Incidental Mutation 'R5997:Nlrp14'
ID480624
Institutional Source Beutler Lab
Gene Symbol Nlrp14
Ensembl Gene ENSMUSG00000016626
Gene NameNLR family, pyrin domain containing 14
Synonyms4921520L01Rik, GC-LRR, Nalp-iota, Nalp14
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5997 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107166990-107198102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107182496 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 300 (T300K)
Ref Sequence ENSEMBL: ENSMUSP00000081819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084763] [ENSMUST00000142623]
Predicted Effect probably benign
Transcript: ENSMUST00000084763
AA Change: T300K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081819
Gene: ENSMUSG00000016626
AA Change: T300K

DomainStartEndE-ValueType
Pfam:NACHT 81 249 1.6e-38 PFAM
Blast:LRR 574 601 4e-6 BLAST
LRR 629 656 1.67e0 SMART
LRR 658 685 1.56e0 SMART
LRR 686 713 2.05e-2 SMART
LRR 715 742 7.9e-4 SMART
LRR 743 770 1.25e-1 SMART
LRR 772 799 4.68e-1 SMART
LRR 800 827 9.08e-4 SMART
LRR 829 856 1.59e1 SMART
LRR 857 884 7.15e-1 SMART
LRR 886 913 6.57e0 SMART
LRR 914 941 3.36e1 SMART
low complexity region 953 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142623
SMART Domains Protein: ENSMUSP00000145427
Gene: ENSMUSG00000016626

DomainStartEndE-ValueType
LRR 27 54 9.1e-5 SMART
LRR 56 83 3.4e-6 SMART
LRR 84 111 5.4e-4 SMART
LRR 113 140 2e-3 SMART
LRR 141 168 4e-6 SMART
LRR 170 197 6.7e-2 SMART
LRR 198 225 3.1e-3 SMART
LRR 227 254 2.8e-2 SMART
LRR 255 282 1.4e-1 SMART
low complexity region 294 304 N/A INTRINSIC
Meta Mutation Damage Score 0.6205 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Nlrp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Nlrp14 APN 7 107192502 missense possibly damaging 0.91
IGL00337:Nlrp14 APN 7 107182101 missense possibly damaging 0.95
IGL00587:Nlrp14 APN 7 107181767 missense probably benign 0.10
IGL00654:Nlrp14 APN 7 107196144 missense probably damaging 1.00
IGL00712:Nlrp14 APN 7 107197241 missense probably damaging 1.00
IGL00765:Nlrp14 APN 7 107190139 missense possibly damaging 0.85
IGL01392:Nlrp14 APN 7 107197913 utr 3 prime probably benign
IGL02325:Nlrp14 APN 7 107182316 missense possibly damaging 0.95
IGL02572:Nlrp14 APN 7 107182722 nonsense probably null
IGL03180:Nlrp14 APN 7 107182626 missense probably benign 0.01
IGL03186:Nlrp14 APN 7 107186670 missense probably damaging 0.98
PIT4403001:Nlrp14 UTSW 7 107184892 missense possibly damaging 0.65
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0148:Nlrp14 UTSW 7 107182721 missense probably benign
R0720:Nlrp14 UTSW 7 107182013 missense probably benign 0.19
R0842:Nlrp14 UTSW 7 107183135 missense probably benign 0.08
R1367:Nlrp14 UTSW 7 107182811 missense probably benign 0.01
R1472:Nlrp14 UTSW 7 107182703 missense probably benign 0.33
R1483:Nlrp14 UTSW 7 107190122 missense possibly damaging 0.84
R1615:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
R1991:Nlrp14 UTSW 7 107196200 missense probably benign 0.21
R2171:Nlrp14 UTSW 7 107182502 missense probably damaging 0.99
R2287:Nlrp14 UTSW 7 107182662 missense probably damaging 1.00
R2394:Nlrp14 UTSW 7 107197824 missense probably benign 0.13
R3151:Nlrp14 UTSW 7 107182552 missense probably benign 0.32
R3732:Nlrp14 UTSW 7 107182367 missense probably benign 0.00
R3793:Nlrp14 UTSW 7 107182274 missense probably benign 0.00
R4368:Nlrp14 UTSW 7 107197805 missense probably benign 0.01
R4652:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R4772:Nlrp14 UTSW 7 107181186 missense probably benign 0.07
R4886:Nlrp14 UTSW 7 107182655 missense probably benign 0.02
R4896:Nlrp14 UTSW 7 107197179 frame shift probably null
R4910:Nlrp14 UTSW 7 107186583 missense possibly damaging 0.93
R5925:Nlrp14 UTSW 7 107186653 missense probably benign 0.35
R6192:Nlrp14 UTSW 7 107182439 missense probably benign 0.00
R6230:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R6799:Nlrp14 UTSW 7 107196139 missense probably benign 0.37
R7116:Nlrp14 UTSW 7 107183048 missense possibly damaging 0.86
R7131:Nlrp14 UTSW 7 107184814 missense possibly damaging 0.47
R7387:Nlrp14 UTSW 7 107183107 missense probably damaging 0.98
R7472:Nlrp14 UTSW 7 107190044 missense probably benign 0.09
R7565:Nlrp14 UTSW 7 107181887 nonsense probably null
R7810:Nlrp14 UTSW 7 107192575 nonsense probably null
X0019:Nlrp14 UTSW 7 107182927 missense probably benign 0.11
X0050:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
Z1088:Nlrp14 UTSW 7 107186622 missense probably damaging 1.00
Z1176:Nlrp14 UTSW 7 107182714 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCTGTCAGGGCTGTCTAAG -3'
(R):5'- AAAAGCAAAATGTCCTCTCTGG -3'

Sequencing Primer
(F):5'- TCAGGGCTGTCTAAGAATGC -3'
(R):5'- GCAAAATGTCCTCTCTGGTTAATTC -3'
Posted On2017-06-26