Incidental Mutation 'R5997:Cep164'
ID480629
Institutional Source Beutler Lab
Gene Symbol Cep164
Ensembl Gene ENSMUSG00000043987
Gene Namecentrosomal protein 164
Synonyms
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5997 (G1)
Quality Score177.009
Status Validated
Chromosome9
Chromosomal Location45766946-45828691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45769463 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 1240 (L1240S)
Ref Sequence ENSEMBL: ENSMUSP00000114053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117194
AA Change: L1240S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: L1240S

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152629
Predicted Effect probably benign
Transcript: ENSMUST00000213154
AA Change: L1941S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214971
Predicted Effect probably benign
Transcript: ENSMUST00000216284
AA Change: L1079S

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Cep164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Cep164 APN 9 45775256 missense possibly damaging 0.46
IGL01571:Cep164 APN 9 45794338 missense possibly damaging 0.82
IGL01985:Cep164 APN 9 45779606 missense probably damaging 1.00
IGL01989:Cep164 APN 9 45793015 splice site probably benign
IGL02130:Cep164 APN 9 45779792 missense possibly damaging 0.82
IGL02598:Cep164 APN 9 45770704 missense probably damaging 1.00
IGL03206:Cep164 APN 9 45802725 missense probably benign 0.00
R0063:Cep164 UTSW 9 45768618 missense possibly damaging 0.83
R0109:Cep164 UTSW 9 45771587 missense probably damaging 1.00
R0528:Cep164 UTSW 9 45776936 unclassified probably benign
R0532:Cep164 UTSW 9 45809826 nonsense probably null
R1445:Cep164 UTSW 9 45778900 missense possibly damaging 0.66
R1753:Cep164 UTSW 9 45792937 missense probably damaging 0.99
R1824:Cep164 UTSW 9 45778928 missense probably damaging 1.00
R1856:Cep164 UTSW 9 45775758 splice site probably null
R1858:Cep164 UTSW 9 45823640 splice site probably benign
R1900:Cep164 UTSW 9 45809825 missense probably damaging 1.00
R1911:Cep164 UTSW 9 45770806 missense probably benign 0.09
R2032:Cep164 UTSW 9 45771600 missense probably damaging 1.00
R2133:Cep164 UTSW 9 45803183 missense probably damaging 1.00
R2186:Cep164 UTSW 9 45768578 missense probably damaging 1.00
R2511:Cep164 UTSW 9 45775249 missense probably damaging 1.00
R4424:Cep164 UTSW 9 45779704 missense possibly damaging 0.92
R5126:Cep164 UTSW 9 45787424 critical splice donor site probably null
R6186:Cep164 UTSW 9 45794109 missense probably damaging 0.98
R6357:Cep164 UTSW 9 45770884 missense probably damaging 1.00
R6385:Cep164 UTSW 9 45779783 missense probably damaging 0.99
R6632:Cep164 UTSW 9 45779790 missense possibly damaging 0.66
R6957:Cep164 UTSW 9 45772280 critical splice donor site probably null
R7310:Cep164 UTSW 9 45775366 missense probably damaging 1.00
R7420:Cep164 UTSW 9 45768542 missense probably benign 0.01
R7651:Cep164 UTSW 9 45773852 missense probably benign 0.18
R8010:Cep164 UTSW 9 45823671 missense unknown
X0024:Cep164 UTSW 9 45775863 critical splice donor site probably null
X0028:Cep164 UTSW 9 45770967 missense probably damaging 1.00
X0065:Cep164 UTSW 9 45774787 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAAGATGTAGGTGTCTCTGGGC -3'
(R):5'- AAAAGTCTTTCGGCTCAGCC -3'

Sequencing Primer
(F):5'- GTCTCTGGGCTGGGGAC -3'
(R):5'- TCAAAGTAAACAGGACAGTTCTTG -3'
Posted On2017-06-26