Incidental Mutation 'R0513:Nedd4l'
ID48063
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 038707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0513 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 65195185 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect probably benign
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably benign
Transcript: ENSMUST00000226058
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 99% (122/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,659 T146A probably benign Het
4930452B06Rik A C 14: 8,536,609 D199E probably damaging Het
5830473C10Rik A T 5: 90,577,927 T333S probably benign Het
6720489N17Rik A C 13: 62,605,215 V99G possibly damaging Het
Abcg4 A G 9: 44,281,687 S121P possibly damaging Het
Actr2 T C 11: 20,080,124 T212A probably damaging Het
Adcy10 T A 1: 165,519,519 D368E probably benign Het
Anapc15 T C 7: 101,898,540 probably benign Het
Aox4 A G 1: 58,217,519 R67G probably benign Het
Aox4 A G 1: 58,247,300 D697G probably damaging Het
Arhgap42 A T 9: 9,005,765 S755T probably benign Het
Atm A G 9: 53,503,948 V881A probably benign Het
Cd163l1 C A 7: 140,224,960 C625* probably null Het
Cdkal1 C T 13: 29,625,965 probably benign Het
Cfap61 C A 2: 146,035,295 N491K possibly damaging Het
Chgb T C 2: 132,785,977 probably benign Het
Chrna1 C A 2: 73,568,082 probably benign Het
Chst10 A G 1: 38,865,763 L283P probably damaging Het
Clca3a1 A G 3: 144,760,562 probably null Het
Cryzl1 G T 16: 91,699,287 A1E possibly damaging Het
Csnk1a1 T C 18: 61,576,547 Y213H probably damaging Het
Cspg4 A G 9: 56,898,091 Q2062R probably benign Het
Ctnnal1 A G 4: 56,835,348 C310R probably benign Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
D930048N14Rik T C 11: 51,654,928 probably benign Het
Dag1 G A 9: 108,208,485 P486S possibly damaging Het
Dgkq A G 5: 108,656,495 L33P probably benign Het
Dlc1 C T 8: 36,584,010 G856R probably damaging Het
Dst T A 1: 34,219,531 probably benign Het
Dtl A T 1: 191,569,707 Y79* probably null Het
Egfr T G 11: 16,872,855 L406R probably damaging Het
Elp3 A T 14: 65,563,246 probably null Het
Fbxw19 C A 9: 109,481,553 probably null Het
Frs2 T C 10: 117,074,665 E264G possibly damaging Het
Fscn2 G T 11: 120,361,880 V58L probably damaging Het
Gm17324 G A 9: 78,448,725 probably benign Het
Gm4787 A T 12: 81,378,312 N357K probably benign Het
Gm9956 G T 10: 56,745,195 Het
Gsg1l C T 7: 126,020,623 probably null Het
Herc1 G A 9: 66,445,645 V2138M possibly damaging Het
Htr2a T C 14: 74,706,324 L448P probably benign Het
Ing3 C T 6: 21,970,035 S255L probably damaging Het
Ispd A T 12: 36,390,468 H125L probably damaging Het
Krt78 T C 15: 101,950,949 D271G probably damaging Het
Lmbrd2 T A 15: 9,194,729 L606H probably damaging Het
Lmod1 T A 1: 135,325,168 N53K probably damaging Het
Lsr G C 7: 30,958,338 A467G probably benign Het
Mbtd1 T A 11: 93,932,212 probably null Het
Mill1 T A 7: 18,264,877 Y337* probably null Het
Mlxipl A T 5: 135,137,263 Q833L probably benign Het
Mon2 C T 10: 123,038,610 V278M probably damaging Het
Mxra8 A C 4: 155,841,733 M180L probably benign Het
Myo18a A T 11: 77,811,594 probably benign Het
Myo1c T G 11: 75,665,831 probably null Het
Myo1g T C 11: 6,510,203 T782A probably benign Het
Ncapd3 A G 9: 27,064,105 probably benign Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nf2 T C 11: 4,791,185 K343R possibly damaging Het
Nfasc A T 1: 132,603,846 D733E possibly damaging Het
Nolc1 G A 19: 46,084,159 D699N probably damaging Het
Nrbp2 C T 15: 76,088,976 A45T probably benign Het
Obscn A G 11: 59,061,522 V3907A possibly damaging Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1371 T C 11: 52,213,749 Q80R possibly damaging Het
Olfr145 A T 9: 37,898,055 Y217F probably damaging Het
Pank2 C T 2: 131,282,606 T290I probably damaging Het
Pbx4 T C 8: 69,864,879 V171A probably benign Het
Pcgf1 G T 6: 83,080,574 V75F probably damaging Het
Pik3ca T C 3: 32,461,511 S778P probably damaging Het
Pld6 T C 11: 59,785,221 I141M probably damaging Het
Polq T A 16: 37,094,502 V2508E probably damaging Het
Prkca C G 11: 108,014,376 D179H possibly damaging Het
Pspn T C 17: 56,999,720 S70G probably damaging Het
Ptchd4 C T 17: 42,503,746 T846I probably benign Het
Reg3g A C 6: 78,467,844 Y50* probably null Het
Rev3l C T 10: 39,828,143 H2062Y probably benign Het
Rsph4a C T 10: 33,912,991 Q611* probably null Het
Scgb1b20 G A 7: 33,373,314 probably null Het
Sfxn5 T C 6: 85,269,973 probably benign Het
Sh3tc1 T A 5: 35,700,307 Q1179L possibly damaging Het
Skint11 A G 4: 114,194,565 I37V probably benign Het
Slc35f5 T C 1: 125,576,169 probably benign Het
Slc8a2 A C 7: 16,157,339 D768A probably damaging Het
Slco6b1 A G 1: 96,997,184 noncoding transcript Het
Smurf2 T A 11: 106,836,105 T453S probably benign Het
Spag16 A G 1: 70,493,768 probably benign Het
Spindoc G A 19: 7,374,144 T205I probably benign Het
Stab1 T C 14: 31,148,945 I1316V probably benign Het
Stox2 T C 8: 47,193,865 R187G probably damaging Het
Tcea2 A C 2: 181,684,481 T93P probably benign Het
Tenm4 T C 7: 96,895,623 M2311T probably benign Het
Tmem63a A G 1: 180,960,461 Q260R probably benign Het
Tnpo2 A T 8: 85,053,529 H698L probably benign Het
Trim33 A G 3: 103,310,384 D215G probably damaging Het
Ttc3 T A 16: 94,426,212 I727N probably damaging Het
Ttn T A 2: 76,943,325 K2271N probably damaging Het
Ubr2 T A 17: 46,986,779 K223* probably null Het
Ubr4 A G 4: 139,416,875 M1410V possibly damaging Het
Ugt2b35 T C 5: 87,003,412 probably benign Het
Ulk4 T A 9: 121,152,325 H880L probably benign Het
Unc80 G A 1: 66,622,474 C1686Y possibly damaging Het
Upf2 T A 2: 5,957,667 L60Q unknown Het
Usf2 A T 7: 30,954,736 probably benign Het
Usp21 T A 1: 171,283,012 probably benign Het
Usp21 T A 1: 171,283,014 probably benign Het
Vmn2r118 T A 17: 55,610,970 K181* probably null Het
Vmn2r124 T A 17: 18,073,729 S693T possibly damaging Het
Vmn2r76 C A 7: 86,228,779 G470V probably benign Het
Vps13c A C 9: 67,930,735 I1856L probably benign Het
Vps50 C T 6: 3,520,210 L119F probably damaging Het
Wdfy3 T A 5: 101,890,789 S2012C probably damaging Het
Zfp142 A G 1: 74,571,555 V924A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp235 T C 7: 24,142,219 S688P probably damaging Het
Zfp39 C T 11: 58,889,987 V650I probably benign Het
Zfp82 A T 7: 30,056,840 N272K probably damaging Het
Zfyve21 A C 12: 111,823,264 D54A possibly damaging Het
Zfyve26 C T 12: 79,244,484 D2116N probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense probably benign
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATTACAGAAAGGCGTGGCTGAC -3'
(R):5'- CTGGGTTCAACCTCCTGAGGAAAAC -3'

Sequencing Primer
(F):5'- TCATATCGGTTGCCACGAAG -3'
(R):5'- TCCTGAGGAAAACCAGCTACAG -3'
Posted On2013-06-12