Incidental Mutation 'R5997:Sik2'
ID480630
Institutional Source Beutler Lab
Gene Symbol Sik2
Ensembl Gene ENSMUSG00000037112
Gene Namesalt inducible kinase 2
SynonymsSnf1lk2
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R5997 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location50892801-51009073 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50895342 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034560] [ENSMUST00000041375] [ENSMUST00000174628] [ENSMUST00000176349] [ENSMUST00000176491] [ENSMUST00000176663] [ENSMUST00000176798] [ENSMUST00000176824]
Predicted Effect probably benign
Transcript: ENSMUST00000034560
SMART Domains Protein: ENSMUSP00000034560
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.2e-6 PFAM
Pfam:HEAT_EZ 182 243 9.9e-6 PFAM
Pfam:HEAT 295 325 5.9e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041375
SMART Domains Protein: ENSMUSP00000038761
Gene: ENSMUSG00000037112

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174628
SMART Domains Protein: ENSMUSP00000133404
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 4.6e-6 PFAM
Pfam:HEAT 217 247 4.5e-5 PFAM
Pfam:HEAT 295 325 4.3e-6 PFAM
Pfam:HEAT_2 378 479 1.7e-11 PFAM
low complexity region 643 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176349
SMART Domains Protein: ENSMUSP00000135758
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 114 144 2e-6 PFAM
Pfam:HEAT_EZ 116 179 8.7e-6 PFAM
Pfam:HEAT 153 183 5.5e-5 PFAM
Pfam:HEAT 231 261 5.3e-6 PFAM
Pfam:HEAT_2 314 415 9.3e-11 PFAM
Pfam:HEAT_2 430 532 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176491
SMART Domains Protein: ENSMUSP00000134954
Gene: ENSMUSG00000037112

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176663
SMART Domains Protein: ENSMUSP00000135376
Gene: ENSMUSG00000037112

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176798
SMART Domains Protein: ENSMUSP00000135525
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.3e-6 PFAM
Pfam:HEAT_EZ 182 243 1e-5 PFAM
Pfam:HEAT 295 325 6e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176824
AA Change: Y923H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134936
Gene: ENSMUSG00000037112
AA Change: Y923H

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit darkened hair color in an agouti background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Sik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Sik2 APN 9 50907463 missense probably damaging 0.96
IGL01552:Sik2 APN 9 50917522 splice site probably benign
IGL02175:Sik2 APN 9 50895609 nonsense probably null
IGL02355:Sik2 APN 9 50917603 nonsense probably null
IGL02362:Sik2 APN 9 50917603 nonsense probably null
IGL03197:Sik2 APN 9 50895773 missense probably damaging 1.00
R0066:Sik2 UTSW 9 50998533 missense probably benign 0.18
R0066:Sik2 UTSW 9 50998533 missense probably benign 0.18
R0109:Sik2 UTSW 9 50899475 missense possibly damaging 0.50
R0109:Sik2 UTSW 9 50899475 missense possibly damaging 0.50
R0416:Sik2 UTSW 9 50995632 missense probably damaging 1.00
R0648:Sik2 UTSW 9 50898745 missense probably benign 0.26
R0714:Sik2 UTSW 9 50907436 missense probably benign 0.13
R1472:Sik2 UTSW 9 51008811 missense probably damaging 1.00
R1592:Sik2 UTSW 9 50995671 missense probably damaging 1.00
R1899:Sik2 UTSW 9 50995674 splice site probably benign
R2032:Sik2 UTSW 9 50995647 missense probably damaging 1.00
R2079:Sik2 UTSW 9 50907406 critical splice donor site probably null
R2853:Sik2 UTSW 9 50898297 missense probably damaging 1.00
R4085:Sik2 UTSW 9 50935385 intron probably benign
R4567:Sik2 UTSW 9 50998576 missense probably damaging 1.00
R5098:Sik2 UTSW 9 50995591 intron probably benign
R5176:Sik2 UTSW 9 50899403 missense probably benign 0.02
R5640:Sik2 UTSW 9 50915506 missense possibly damaging 0.93
R5682:Sik2 UTSW 9 50917082 missense probably damaging 1.00
R5779:Sik2 UTSW 9 50895845 missense probably benign
R5935:Sik2 UTSW 9 50917131 missense probably damaging 1.00
R6664:Sik2 UTSW 9 50935457 missense probably damaging 1.00
R6787:Sik2 UTSW 9 50998534 missense possibly damaging 0.67
R6980:Sik2 UTSW 9 50897455 missense probably benign 0.00
R7057:Sik2 UTSW 9 50998561 missense probably damaging 1.00
R7064:Sik2 UTSW 9 50907420 missense probably damaging 0.99
R7165:Sik2 UTSW 9 50917097 missense probably damaging 1.00
R7892:Sik2 UTSW 9 51008832 missense probably damaging 0.98
R7975:Sik2 UTSW 9 51008832 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCAGGAGGAACATCTACC -3'
(R):5'- AGACTTGTGAGCTGCCAAG -3'

Sequencing Primer
(F):5'- AGGAGGAACATCTACCCTAGTC -3'
(R):5'- GCCAAGCACCACTTCTTCTG -3'
Posted On2017-06-26