Incidental Mutation 'R5997:Rbms3'
ID480633
Institutional Source Beutler Lab
Gene Symbol Rbms3
Ensembl Gene ENSMUSG00000039607
Gene NameRNA binding motif, single stranded interacting protein
Synonyms
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5997 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location116572746-117629913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116719389 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 61 (D61G)
Ref Sequence ENSEMBL: ENSMUSP00000133900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044901] [ENSMUST00000068962] [ENSMUST00000111772] [ENSMUST00000111773] [ENSMUST00000164018] [ENSMUST00000173429] [ENSMUST00000174868]
Predicted Effect probably damaging
Transcript: ENSMUST00000044901
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039706
Gene: ENSMUSG00000039607
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068962
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066735
Gene: ENSMUSG00000039607
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 384 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069095
Predicted Effect probably damaging
Transcript: ENSMUST00000111772
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107402
Gene: ENSMUSG00000039607
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 385 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111773
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107403
Gene: ENSMUSG00000039607
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 401 411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164018
AA Change: D268G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131371
Gene: ENSMUSG00000039607
AA Change: D268G

DomainStartEndE-ValueType
low complexity region 76 98 N/A INTRINSIC
RRM 106 174 1.2e-17 SMART
RRM 185 257 1.49e-13 SMART
low complexity region 433 443 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172469
AA Change: D65G
SMART Domains Protein: ENSMUSP00000134172
Gene: ENSMUSG00000039607
AA Change: D65G

DomainStartEndE-ValueType
Pfam:RRM_1 1 50 9.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173429
AA Change: D61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133900
Gene: ENSMUSG00000039607
AA Change: D61G

DomainStartEndE-ValueType
Blast:RRM 1 50 2e-29 BLAST
PDB:1X5O|A 1 60 3e-31 PDB
SCOP:d1h6kx_ 1 62 4e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174868
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133621
Gene: ENSMUSG00000039607
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Rbms3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Rbms3 APN 9 117110115 missense probably damaging 0.99
IGL01859:Rbms3 APN 9 116959538 missense probably damaging 1.00
IGL01962:Rbms3 APN 9 116695811 splice site probably benign
IGL03034:Rbms3 APN 9 117251811 utr 5 prime probably benign
PIT4810001:Rbms3 UTSW 9 117056793 missense probably damaging 0.98
R0862:Rbms3 UTSW 9 117629792 splice site probably benign
R0864:Rbms3 UTSW 9 117629792 splice site probably benign
R0939:Rbms3 UTSW 9 117109960 critical splice donor site probably null
R1796:Rbms3 UTSW 9 116719333 missense probably damaging 1.00
R1808:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R1826:Rbms3 UTSW 9 116822868 missense probably damaging 1.00
R2213:Rbms3 UTSW 9 116959466 critical splice donor site probably null
R3719:Rbms3 UTSW 9 116582862 missense probably benign 0.11
R3935:Rbms3 UTSW 9 116636391 missense probably damaging 1.00
R4270:Rbms3 UTSW 9 117056748 missense probably damaging 1.00
R4822:Rbms3 UTSW 9 116944373 intron probably benign
R4943:Rbms3 UTSW 9 116678505 intron probably benign
R5445:Rbms3 UTSW 9 117251785 missense possibly damaging 0.74
R6848:Rbms3 UTSW 9 117251741 missense probably damaging 1.00
R6944:Rbms3 UTSW 9 117110105 missense probably damaging 0.99
R7205:Rbms3 UTSW 9 116586017 critical splice donor site probably null
R7419:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTGTGCATGTTCTTCACG -3'
(R):5'- ACCAATCAGTGAAGCTCAGAGG -3'

Sequencing Primer
(F):5'- TACGTTCTGGGGATCCAAAC -3'
(R):5'- CAATCAGTGAAGCTCAGAGGAAAGAG -3'
Posted On2017-06-26