Mutagenetix > Incidental Mutation

Incidental Mutation 'R5997:Rnf112'

480637

Institutional Source

Beutler Lab

Gene Symbol

Rnf112

Ensembl Gene

ENSMUSG00000010086

Gene Name

ring finger protein 112

Synonyms

Zfp179, bfp

MMRRC Submission

044176-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5997 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61448442-61454131 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 61451022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 319 (V319M)

Ref Sequence

ENSEMBL: ENSMUSP00000059903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]

AlphaFold

Q96DY5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054927
AA Change: V319M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: V319M

Domain	Start	End	E-Value	Type
RING	80	120	3.78e-5	SMART
low complexity region	139	150	N/A	INTRINSIC
Pfam:GBP	171	423	1.3e-21	PFAM
low complexity region	541	557	N/A	INTRINSIC
transmembrane domain	570	592	N/A	INTRINSIC
transmembrane domain	605	627	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060255
AA Change: V319M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: V319M

Domain	Start	End	E-Value	Type
RING	80	120	3.78e-5	SMART
low complexity region	139	150	N/A	INTRINSIC
Pfam:GBP	171	448	2.8e-21	PFAM
low complexity region	566	582	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
transmembrane domain	630	652	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102661
AA Change: V296M

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: V296M

Domain	Start	End	E-Value	Type
RING	57	97	1.7e-7	SMART
low complexity region	116	127	N/A	INTRINSIC
Pfam:GBP	148	400	2.7e-19	PFAM
low complexity region	518	534	N/A	INTRINSIC
transmembrane domain	547	569	N/A	INTRINSIC
transmembrane domain	582	604	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152137

Meta Mutation Damage Score

0.0858

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.1%
20x: 90.5%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,373	D38V	probably benign	Het
Abcb9	A	T	5: 124,089,815	V121E	possibly damaging	Het
Adamts20	T	A	15: 94,379,747	Y278F	probably damaging	Het
Adcy7	A	T	8: 88,326,392	D972V	probably benign	Het
Adgrf3	C	A	5: 30,198,362		probably null	Het
Ahdc1	G	T	4: 133,063,895	G816C	probably benign	Het
Aifm3	A	G	16: 17,502,130	K283E	probably benign	Het
Akap6	T	C	12: 52,937,233		probably null	Het
Ank1	T	C	8: 23,099,662	L593P	probably damaging	Het
Apol11b	T	A	15: 77,635,497	T128S	probably benign	Het
C1qtnf7	C	A	5: 43,616,085	T235K	probably damaging	Het
Camk2a	A	T	18: 60,977,957	I73F	probably damaging	Het
Cd109	G	T	9: 78,705,062	V1244F	possibly damaging	Het
Cep164	A	G	9: 45,769,463	L1240S	possibly damaging	Het
Cnga1	T	A	5: 72,604,575	D532V	probably damaging	Het
Cyp4a14	A	T	4: 115,496,100	L5*	probably null	Het
Cyp4a30b	A	T	4: 115,459,391	K405*	probably null	Het
Dchs1	T	C	7: 105,754,095	D3080G	probably benign	Het
Ddx1	T	C	12: 13,237,799	D168G	probably damaging	Het
Dhx57	T	G	17: 80,245,806	K1231Q	probably damaging	Het
Dnah14	A	G	1: 181,770,105	N3640D	probably benign	Het
Dock4	T	A	12: 40,755,834	L935Q	probably damaging	Het
Dus2	A	T	8: 106,046,066	R269S	probably benign	Het
E230025N22Rik	G	A	18: 36,689,108	R201C	possibly damaging	Het
Erbb3	G	A	10: 128,583,185	T269M	probably damaging	Het
Fam71f2	T	A	6: 29,290,424	L267*	probably null	Het
Fbxo43	T	C	15: 36,162,093	R323G	probably damaging	Het
Fktn	A	G	4: 53,735,061	H233R	probably benign	Het
Ftsj3	A	T	11: 106,252,251	D412E	probably damaging	Het
Fzd7	A	T	1: 59,484,544	M529L	probably benign	Het
Fzr1	T	A	10: 81,370,826		probably null	Het
Ganc	T	G	2: 120,430,605	V257G	possibly damaging	Het
Gm4131	T	C	14: 62,464,758	K254E	probably damaging	Het
Gm6583	C	T	5: 112,355,008	V277M	possibly damaging	Het
Gm7347	G	T	5: 26,057,249	Y91*	probably null	Het
Gm9857	G	A	3: 108,940,165		probably benign	Het
Grpel1	T	C	5: 36,465,248	S19P	probably benign	Het
Gtf3c4	T	C	2: 28,833,711	K670E	possibly damaging	Het
Hist1h2bf	G	A	13: 23,574,103		probably benign	Het
Hmcn1	G	T	1: 150,704,173	Q1938K	possibly damaging	Het
Hnrnpk	T	C	13: 58,399,157	D71G	probably damaging	Het
Hspa4l	G	A	3: 40,767,979	R311H	probably damaging	Het
Igkv3-5	T	A	6: 70,663,704	F56L	probably benign	Het
Igkv6-20	T	A	6: 70,335,914	T92S	possibly damaging	Het
Krt8	C	T	15: 102,000,594	V200I	possibly damaging	Het
Lamb2	A	T	9: 108,480,388	T66S	possibly damaging	Het
Lamp3	A	G	16: 19,701,028	L135S	probably benign	Het
Lrguk	A	G	6: 34,129,143	Y701C	probably damaging	Het
Mcc	G	T	18: 44,449,321	L588M	probably damaging	Het
Mcidas	T	A	13: 112,998,586	L234Q	probably damaging	Het
Mtmr14	T	A	6: 113,280,614	L208Q	probably damaging	Het
Myof	A	G	19: 37,905,299	F1139L	possibly damaging	Het
Nlrp14	C	A	7: 107,182,496	T300K	probably benign	Het
Olfr1474	A	G	19: 13,471,506	I179V	probably benign	Het
Olfr165	T	A	16: 19,407,944	H24L	probably benign	Het
Olfr716	A	T	7: 107,147,328	E4V	possibly damaging	Het
Olfr890	A	T	9: 38,143,801	Y217F	probably damaging	Het
Orc2	A	G	1: 58,472,388	I354T	probably damaging	Het
Pard3b	G	T	1: 62,076,409	S140I	probably damaging	Het
Pcgf5	A	G	19: 36,434,603	D49G	probably benign	Het
Pcsk6	T	C	7: 65,959,293	F388S	probably damaging	Het
Prokr2	A	C	2: 132,381,442	I60S	probably damaging	Het
Rab33b	A	G	3: 51,484,479	T50A	possibly damaging	Het
Rbms3	T	C	9: 116,719,389	D61G	probably damaging	Het
Rhcg	T	A	7: 79,600,514	K274*	probably null	Het
Rnf44	A	T	13: 54,682,800	S265T	possibly damaging	Het
Sf3a3	A	G	4: 124,722,058	D168G	probably damaging	Het
Sik2	A	G	9: 50,895,342		probably null	Het
Slco1a5	T	A	6: 142,253,113	L275F	probably benign	Het
Smtnl1	T	C	2: 84,815,378	H383R	probably damaging	Het
Spns3	T	G	11: 72,539,078	T175P	probably damaging	Het
Togaram1	A	G	12: 64,995,538	T1174A	probably benign	Het
Tradd	C	T	8: 105,260,645	E10K	possibly damaging	Het
Ttc7b	A	T	12: 100,373,560	Y579N	probably damaging	Het
Uncx	G	A	5: 139,547,589	G470R	probably damaging	Het
Vav3	T	A	3: 109,501,461	M177K	probably damaging	Het
Wfs1	A	T	5: 36,967,750	I599N	probably damaging	Het
Zfp454	G	A	11: 50,873,622	H217Y	probably damaging	Het

Other mutations in Rnf112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Rnf112	APN	11	61452784	missense	probably damaging	1.00
IGL01339:Rnf112	APN	11	61450477	missense	probably benign	0.00
IGL01469:Rnf112	APN	11	61451341	missense	possibly damaging	0.94
IGL02102:Rnf112	APN	11	61452015	missense	probably benign	0.36
IGL02216:Rnf112	APN	11	61449978	missense	probably damaging	1.00
IGL02431:Rnf112	APN	11	61450379	missense	probably benign	0.17
IGL02638:Rnf112	APN	11	61449405	utr 3 prime	probably benign
IGL02657:Rnf112	APN	11	61450252	splice site	probably null
R0041:Rnf112	UTSW	11	61452355	missense	probably damaging	1.00
R1514:Rnf112	UTSW	11	61450410	missense	probably benign	0.01
R1991:Rnf112	UTSW	11	61452426	missense	probably damaging	1.00
R2119:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R2216:Rnf112	UTSW	11	61452279	missense	probably damaging	1.00
R2880:Rnf112	UTSW	11	61450467	missense	possibly damaging	0.89
R3775:Rnf112	UTSW	11	61450185	splice site	probably benign
R3904:Rnf112	UTSW	11	61450385	missense	probably damaging	1.00
R4646:Rnf112	UTSW	11	61452110	missense	probably damaging	0.99
R4710:Rnf112	UTSW	11	61449831	missense	probably damaging	1.00
R4860:Rnf112	UTSW	11	61452744	missense	possibly damaging	0.67
R4860:Rnf112	UTSW	11	61452744	missense	possibly damaging	0.67
R4894:Rnf112	UTSW	11	61452662	missense	probably damaging	1.00
R4930:Rnf112	UTSW	11	61453465	missense	probably benign
R4967:Rnf112	UTSW	11	61452926	splice site	probably benign
R4992:Rnf112	UTSW	11	61452711	missense	possibly damaging	0.72
R5547:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R5874:Rnf112	UTSW	11	61449447	missense	probably damaging	0.98
R6023:Rnf112	UTSW	11	61449729	missense	probably damaging	1.00
R6906:Rnf112	UTSW	11	61450389	missense	probably null	0.38
R7194:Rnf112	UTSW	11	61450857	missense	probably damaging	1.00
R7439:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R7984:Rnf112	UTSW	11	61449480	missense	possibly damaging	0.79
R8984:Rnf112	UTSW	11	61452451	missense	possibly damaging	0.90
R9756:Rnf112	UTSW	11	61449841	missense	probably damaging	1.00
Z1177:Rnf112	UTSW	11	61449679	missense	probably damaging	1.00
Z1186:Rnf112	UTSW	11	61450949	missense	unknown
Z1187:Rnf112	UTSW	11	61450949	missense	unknown
Z1188:Rnf112	UTSW	11	61450949	missense	unknown
Z1189:Rnf112	UTSW	11	61450949	missense	unknown
Z1190:Rnf112	UTSW	11	61450949	missense	unknown
Z1191:Rnf112	UTSW	11	61450949	missense	unknown
Z1192:Rnf112	UTSW	11	61450949	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGGAGTATGTCACCCACGTG -3'
(R):5'- GAAATCATGGCTTCCCTTTCAGG -3'

Sequencing Primer
(F):5'- GCCCTTGCCCTGACTTATTATGATG -3'
(R):5'- CATGGCTTCCCTTTCAGGTTTAGAG -3'

Posted On

2017-06-26