Incidental Mutation 'R5997:Ddx1'
ID480640
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5997 (G1)
Quality Score186.009
Status Validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13237799 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 168 (D168G)
Ref Sequence ENSEMBL: ENSMUSP00000152513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103] [ENSMUST00000221623]
Predicted Effect probably benign
Transcript: ENSMUST00000071103
AA Change: D211G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: D211G

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221623
AA Change: D168G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hist1h2bf G A 13: 23,574,103 probably benign Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATTATCTGGGGCCTTGGAAAG -3'
(R):5'- TGAAGTCACACGGTAACTAGG -3'

Sequencing Primer
(F):5'- CTGGAATAGTCGAACCTCTGACTG -3'
(R):5'- CACACGGTAACTAGGTTGGCTCTAG -3'
Posted On2017-06-26