Incidental Mutation 'R5997:Hist1h2bf'
ID480645
Institutional Source Beutler Lab
Gene Symbol Hist1h2bf
Ensembl Gene ENSMUSG00000069268
Gene Namehistone cluster 1, H2bf
Synonyms
MMRRC Submission 044176-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R5997 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23573736-23574196 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 23574103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079251] [ENSMUST00000090776] [ENSMUST00000102969] [ENSMUST00000105105] [ENSMUST00000105106]
PDB Structure
Crystal structure of RAG2-PHD finger in complex with H3R2me2aK4me3 peptide [X-RAY DIFFRACTION]
Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me3 peptide [X-RAY DIFFRACTION]
Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me2 peptide [X-RAY DIFFRACTION]
Histone demethylase KDM2A-H3K36ME1-alpha-KG complex structure [X-RAY DIFFRACTION]
Crystal structure of histone demethylase kdm2a-h3k36me2 with alpha-kg [X-RAY DIFFRACTION]
Crystal structure of histone demethylase kdm2a-h3k36me3 complex with alpha-kg [X-RAY DIFFRACTION]
crystal structure of histone demethylase KDM2A-H3K36ME3 with NOG [X-RAY DIFFRACTION]
Crystal structure of histone demethylase KDM2A-H3K36ME2 with NOG [X-RAY DIFFRACTION]
Crystal structure of histone demethylase KDM2A-H3K36ME1 with NOG [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079251
SMART Domains Protein: ENSMUSP00000078239
Gene: ENSMUSG00000058385

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090776
SMART Domains Protein: ENSMUSP00000088281
Gene: ENSMUSG00000071478

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102969
SMART Domains Protein: ENSMUSP00000100034
Gene: ENSMUSG00000069272

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105105
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105106
AA Change: R30C
SMART Domains Protein: ENSMUSP00000100738
Gene: ENSMUSG00000069268
AA Change: R30C

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200671
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.5%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,373 D38V probably benign Het
Abcb9 A T 5: 124,089,815 V121E possibly damaging Het
Adamts20 T A 15: 94,379,747 Y278F probably damaging Het
Adcy7 A T 8: 88,326,392 D972V probably benign Het
Adgrf3 C A 5: 30,198,362 probably null Het
Ahdc1 G T 4: 133,063,895 G816C probably benign Het
Aifm3 A G 16: 17,502,130 K283E probably benign Het
Akap6 T C 12: 52,937,233 probably null Het
Ank1 T C 8: 23,099,662 L593P probably damaging Het
Apol11b T A 15: 77,635,497 T128S probably benign Het
C1qtnf7 C A 5: 43,616,085 T235K probably damaging Het
Camk2a A T 18: 60,977,957 I73F probably damaging Het
Cd109 G T 9: 78,705,062 V1244F possibly damaging Het
Cep164 A G 9: 45,769,463 L1240S possibly damaging Het
Cnga1 T A 5: 72,604,575 D532V probably damaging Het
Cyp4a14 A T 4: 115,496,100 L5* probably null Het
Cyp4a30b A T 4: 115,459,391 K405* probably null Het
Dchs1 T C 7: 105,754,095 D3080G probably benign Het
Ddx1 T C 12: 13,237,799 D168G probably damaging Het
Dhx57 T G 17: 80,245,806 K1231Q probably damaging Het
Dnah14 A G 1: 181,770,105 N3640D probably benign Het
Dock4 T A 12: 40,755,834 L935Q probably damaging Het
Dus2 A T 8: 106,046,066 R269S probably benign Het
E230025N22Rik G A 18: 36,689,108 R201C possibly damaging Het
Erbb3 G A 10: 128,583,185 T269M probably damaging Het
Fam71f2 T A 6: 29,290,424 L267* probably null Het
Fbxo43 T C 15: 36,162,093 R323G probably damaging Het
Fktn A G 4: 53,735,061 H233R probably benign Het
Ftsj3 A T 11: 106,252,251 D412E probably damaging Het
Fzd7 A T 1: 59,484,544 M529L probably benign Het
Fzr1 T A 10: 81,370,826 probably null Het
Ganc T G 2: 120,430,605 V257G possibly damaging Het
Gm4131 T C 14: 62,464,758 K254E probably damaging Het
Gm6583 C T 5: 112,355,008 V277M possibly damaging Het
Gm7347 G T 5: 26,057,249 Y91* probably null Het
Gm9857 G A 3: 108,940,165 probably benign Het
Grpel1 T C 5: 36,465,248 S19P probably benign Het
Gtf3c4 T C 2: 28,833,711 K670E possibly damaging Het
Hmcn1 G T 1: 150,704,173 Q1938K possibly damaging Het
Hnrnpk T C 13: 58,399,157 D71G probably damaging Het
Hspa4l G A 3: 40,767,979 R311H probably damaging Het
Igkv3-5 T A 6: 70,663,704 F56L probably benign Het
Igkv6-20 T A 6: 70,335,914 T92S possibly damaging Het
Krt8 C T 15: 102,000,594 V200I possibly damaging Het
Lamb2 A T 9: 108,480,388 T66S possibly damaging Het
Lamp3 A G 16: 19,701,028 L135S probably benign Het
Lrguk A G 6: 34,129,143 Y701C probably damaging Het
Mcc G T 18: 44,449,321 L588M probably damaging Het
Mcidas T A 13: 112,998,586 L234Q probably damaging Het
Mtmr14 T A 6: 113,280,614 L208Q probably damaging Het
Myof A G 19: 37,905,299 F1139L possibly damaging Het
Nlrp14 C A 7: 107,182,496 T300K probably benign Het
Olfr1474 A G 19: 13,471,506 I179V probably benign Het
Olfr165 T A 16: 19,407,944 H24L probably benign Het
Olfr716 A T 7: 107,147,328 E4V possibly damaging Het
Olfr890 A T 9: 38,143,801 Y217F probably damaging Het
Orc2 A G 1: 58,472,388 I354T probably damaging Het
Pard3b G T 1: 62,076,409 S140I probably damaging Het
Pcgf5 A G 19: 36,434,603 D49G probably benign Het
Pcsk6 T C 7: 65,959,293 F388S probably damaging Het
Prokr2 A C 2: 132,381,442 I60S probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Rbms3 T C 9: 116,719,389 D61G probably damaging Het
Rhcg T A 7: 79,600,514 K274* probably null Het
Rnf112 C T 11: 61,451,022 V319M possibly damaging Het
Rnf44 A T 13: 54,682,800 S265T possibly damaging Het
Sf3a3 A G 4: 124,722,058 D168G probably damaging Het
Sik2 A G 9: 50,895,342 probably null Het
Slco1a5 T A 6: 142,253,113 L275F probably benign Het
Smtnl1 T C 2: 84,815,378 H383R probably damaging Het
Spns3 T G 11: 72,539,078 T175P probably damaging Het
Togaram1 A G 12: 64,995,538 T1174A probably benign Het
Tradd C T 8: 105,260,645 E10K possibly damaging Het
Ttc7b A T 12: 100,373,560 Y579N probably damaging Het
Uncx G A 5: 139,547,589 G470R probably damaging Het
Vav3 T A 3: 109,501,461 M177K probably damaging Het
Wfs1 A T 5: 36,967,750 I599N probably damaging Het
Zfp454 G A 11: 50,873,622 H217Y probably damaging Het
Other mutations in Hist1h2bf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3004:Hist1h2bf UTSW 13 23574181 unclassified probably benign
R4610:Hist1h2bf UTSW 13 23574057 missense possibly damaging 0.87
R6131:Hist1h2bf UTSW 13 23574136 unclassified probably benign
R7873:Hist1h2bf UTSW 13 23574070 missense probably damaging 1.00
R7956:Hist1h2bf UTSW 13 23574070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTGTTGTAATGCGCCAG -3'
(R):5'- CACGTTGATTGGGCAAGACTTC -3'

Sequencing Primer
(F):5'- GAGTTCATGATGCCCATG -3'
(R):5'- GGCAAGACTTCGTATGCCATC -3'
Posted On2017-06-26