Incidental Mutation 'R0513:Nolc1'
ID 48065
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Name nucleolar and coiled-body phosphoprotein 1
Synonyms 3230402K17Rik, P130, NOPP140
MMRRC Submission 038707-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0513 (G1)
Quality Score 160
Status Not validated
Chromosome 19
Chromosomal Location 46064302-46073969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46072598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 699 (D699N)
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
AlphaFold E9Q5C9
Predicted Effect probably damaging
Transcript: ENSMUST00000165017
AA Change: D700N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176
AA Change: D700N

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000223683
AA Change: D699N
Predicted Effect probably damaging
Transcript: ENSMUST00000223728
AA Change: D698N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect probably damaging
Transcript: ENSMUST00000225780
AA Change: D699N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 99% (122/123)
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,606,195 (GRCm39) T146A probably benign Het
Abcg4 A G 9: 44,192,984 (GRCm39) S121P possibly damaging Het
Actr2 T C 11: 20,030,124 (GRCm39) T212A probably damaging Het
Adcy10 T A 1: 165,347,088 (GRCm39) D368E probably benign Het
Albfm1 A T 5: 90,725,786 (GRCm39) T333S probably benign Het
Anapc15 T C 7: 101,547,747 (GRCm39) probably benign Het
Aox4 A G 1: 58,256,678 (GRCm39) R67G probably benign Het
Aox4 A G 1: 58,286,459 (GRCm39) D697G probably damaging Het
Arhgap42 A T 9: 9,005,766 (GRCm39) S755T probably benign Het
Atm A G 9: 53,415,248 (GRCm39) V881A probably benign Het
Cdkal1 C T 13: 29,809,948 (GRCm39) probably benign Het
Cfap20dc A C 14: 8,536,609 (GRCm38) D199E probably damaging Het
Cfap61 C A 2: 145,877,215 (GRCm39) N491K possibly damaging Het
Chgb T C 2: 132,627,897 (GRCm39) probably benign Het
Chrna1 C A 2: 73,398,426 (GRCm39) probably benign Het
Chst10 A G 1: 38,904,844 (GRCm39) L283P probably damaging Het
Clca3a1 A G 3: 144,466,323 (GRCm39) probably null Het
Crppa A T 12: 36,440,467 (GRCm39) H125L probably damaging Het
Cryzl1 G T 16: 91,496,175 (GRCm39) A1E possibly damaging Het
Csnk1a1 T C 18: 61,709,618 (GRCm39) Y213H probably damaging Het
Cspg4 A G 9: 56,805,375 (GRCm39) Q2062R probably benign Het
Ctnnal1 A G 4: 56,835,348 (GRCm39) C310R probably benign Het
D630003M21Rik T C 2: 158,042,228 (GRCm39) E906G probably benign Het
D930048N14Rik T C 11: 51,545,755 (GRCm39) probably benign Het
Dag1 G A 9: 108,085,684 (GRCm39) P486S possibly damaging Het
Dgkq A G 5: 108,804,361 (GRCm39) L33P probably benign Het
Dlc1 C T 8: 37,051,164 (GRCm39) G856R probably damaging Het
Dst T A 1: 34,258,612 (GRCm39) probably benign Het
Dtl A T 1: 191,301,819 (GRCm39) Y79* probably null Het
Egfr T G 11: 16,822,855 (GRCm39) L406R probably damaging Het
Elp3 A T 14: 65,800,695 (GRCm39) probably null Het
Fbxw19 C A 9: 109,310,621 (GRCm39) probably null Het
Frs2 T C 10: 116,910,570 (GRCm39) E264G possibly damaging Het
Fscn2 G T 11: 120,252,706 (GRCm39) V58L probably damaging Het
Gm17324 G A 9: 78,356,007 (GRCm39) probably benign Het
Gm4787 A T 12: 81,425,086 (GRCm39) N357K probably benign Het
Gm9956 G T 10: 56,621,291 (GRCm39) Het
Gsg1l C T 7: 125,619,795 (GRCm39) probably null Het
Herc1 G A 9: 66,352,927 (GRCm39) V2138M possibly damaging Het
Htr2a T C 14: 74,943,764 (GRCm39) L448P probably benign Het
Ing3 C T 6: 21,970,034 (GRCm39) S255L probably damaging Het
Krt78 T C 15: 101,859,384 (GRCm39) D271G probably damaging Het
Lmbrd2 T A 15: 9,194,816 (GRCm39) L606H probably damaging Het
Lmod1 T A 1: 135,252,906 (GRCm39) N53K probably damaging Het
Lsr G C 7: 30,657,763 (GRCm39) A467G probably benign Het
Mbtd1 T A 11: 93,823,038 (GRCm39) probably null Het
Mill1 T A 7: 17,998,802 (GRCm39) Y337* probably null Het
Mlxipl A T 5: 135,166,117 (GRCm39) Q833L probably benign Het
Mon2 C T 10: 122,874,515 (GRCm39) V278M probably damaging Het
Mxra8 A C 4: 155,926,190 (GRCm39) M180L probably benign Het
Myo18a A T 11: 77,702,420 (GRCm39) probably benign Het
Myo1c T G 11: 75,556,657 (GRCm39) probably null Het
Myo1g T C 11: 6,460,203 (GRCm39) T782A probably benign Het
Ncapd3 A G 9: 26,975,401 (GRCm39) probably benign Het
Neb T C 2: 52,198,699 (GRCm39) D414G probably damaging Het
Nedd4l T A 18: 65,328,256 (GRCm39) probably benign Het
Nf2 T C 11: 4,741,185 (GRCm39) K343R possibly damaging Het
Nfasc A T 1: 132,531,584 (GRCm39) D733E possibly damaging Het
Nrbp2 C T 15: 75,960,825 (GRCm39) A45T probably benign Het
Obscn A G 11: 58,952,348 (GRCm39) V3907A possibly damaging Het
Or2b6 A T 13: 21,823,119 (GRCm39) D191E probably benign Het
Or2y6 T C 11: 52,104,576 (GRCm39) Q80R possibly damaging Het
Or8b8 A T 9: 37,809,351 (GRCm39) Y217F probably damaging Het
Pank2 C T 2: 131,124,526 (GRCm39) T290I probably damaging Het
Pbx4 T C 8: 70,317,529 (GRCm39) V171A probably benign Het
Pcgf1 G T 6: 83,057,555 (GRCm39) V75F probably damaging Het
Pik3ca T C 3: 32,515,660 (GRCm39) S778P probably damaging Het
Pld6 T C 11: 59,676,047 (GRCm39) I141M probably damaging Het
Polq T A 16: 36,914,864 (GRCm39) V2508E probably damaging Het
Prkca C G 11: 107,905,202 (GRCm39) D179H possibly damaging Het
Pspn T C 17: 57,306,720 (GRCm39) S70G probably damaging Het
Ptchd4 C T 17: 42,814,637 (GRCm39) T846I probably benign Het
Reg3g A C 6: 78,444,827 (GRCm39) Y50* probably null Het
Rev3l C T 10: 39,704,139 (GRCm39) H2062Y probably benign Het
Rsph4a C T 10: 33,788,987 (GRCm39) Q611* probably null Het
Scart1 C A 7: 139,804,873 (GRCm39) C625* probably null Het
Scgb1b20 G A 7: 33,072,739 (GRCm39) probably null Het
Sfxn5 T C 6: 85,246,955 (GRCm39) probably benign Het
Sh3tc1 T A 5: 35,857,651 (GRCm39) Q1179L possibly damaging Het
Skint11 A G 4: 114,051,762 (GRCm39) I37V probably benign Het
Slc35f5 T C 1: 125,503,906 (GRCm39) probably benign Het
Slc8a2 A C 7: 15,891,264 (GRCm39) D768A probably damaging Het
Slco6b1 A G 1: 96,924,909 (GRCm39) noncoding transcript Het
Smurf2 T A 11: 106,726,931 (GRCm39) T453S probably benign Het
Spag16 A G 1: 70,532,927 (GRCm39) probably benign Het
Spindoc G A 19: 7,351,509 (GRCm39) T205I probably benign Het
Stab1 T C 14: 30,870,902 (GRCm39) I1316V probably benign Het
Stox2 T C 8: 47,646,900 (GRCm39) R187G probably damaging Het
Tcea2 A C 2: 181,326,274 (GRCm39) T93P probably benign Het
Tenm4 T C 7: 96,544,830 (GRCm39) M2311T probably benign Het
Tmem63a A G 1: 180,788,026 (GRCm39) Q260R probably benign Het
Tnpo2 A T 8: 85,780,158 (GRCm39) H698L probably benign Het
Trim33 A G 3: 103,217,700 (GRCm39) D215G probably damaging Het
Ttc3 T A 16: 94,227,071 (GRCm39) I727N probably damaging Het
Ttn T A 2: 76,773,669 (GRCm39) K2271N probably damaging Het
Ubr2 T A 17: 47,297,705 (GRCm39) K223* probably null Het
Ubr4 A G 4: 139,144,186 (GRCm39) M1410V possibly damaging Het
Ugt2b35 T C 5: 87,151,271 (GRCm39) probably benign Het
Ulk4 T A 9: 120,981,391 (GRCm39) H880L probably benign Het
Unc80 G A 1: 66,661,633 (GRCm39) C1686Y possibly damaging Het
Upf2 T A 2: 5,962,478 (GRCm39) L60Q unknown Het
Usf2 A T 7: 30,654,161 (GRCm39) probably benign Het
Usp21 T A 1: 171,110,586 (GRCm39) probably benign Het
Usp21 T A 1: 171,110,588 (GRCm39) probably benign Het
Vmn2r118 T A 17: 55,917,970 (GRCm39) K181* probably null Het
Vmn2r124 T A 17: 18,293,991 (GRCm39) S693T possibly damaging Het
Vmn2r76 C A 7: 85,877,987 (GRCm39) G470V probably benign Het
Vps13c A C 9: 67,838,017 (GRCm39) I1856L probably benign Het
Vps50 C T 6: 3,520,210 (GRCm39) L119F probably damaging Het
Wdfy3 T A 5: 102,038,655 (GRCm39) S2012C probably damaging Het
Zfp1008 A C 13: 62,753,029 (GRCm39) V99G possibly damaging Het
Zfp142 A G 1: 74,610,714 (GRCm39) V924A probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp235 T C 7: 23,841,644 (GRCm39) S688P probably damaging Het
Zfp39 C T 11: 58,780,813 (GRCm39) V650I probably benign Het
Zfp82 A T 7: 29,756,265 (GRCm39) N272K probably damaging Het
Zfyve21 A C 12: 111,789,698 (GRCm39) D54A possibly damaging Het
Zfyve26 C T 12: 79,291,258 (GRCm39) D2116N probably damaging Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46,071,468 (GRCm39) unclassified probably benign
FR4976:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
FR4976:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R0106:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R0121:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0140:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0501:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R1553:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
R1642:Nolc1 UTSW 19 46,067,461 (GRCm39) critical splice donor site probably null
R1698:Nolc1 UTSW 19 46,069,870 (GRCm39) splice site probably null
R2067:Nolc1 UTSW 19 46,072,046 (GRCm39) missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46,069,800 (GRCm39) small insertion probably benign
R2113:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,807 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2895:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R2999:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R3737:Nolc1 UTSW 19 46,069,816 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,792 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,809 (GRCm39) small insertion probably benign
R3747:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R3806:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
R4035:Nolc1 UTSW 19 46,069,797 (GRCm39) small insertion probably benign
R4619:Nolc1 UTSW 19 46,071,959 (GRCm39) missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R4999:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46,070,103 (GRCm39) nonsense probably null
R5559:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R5837:Nolc1 UTSW 19 46,071,622 (GRCm39) unclassified probably benign
R6457:Nolc1 UTSW 19 46,071,509 (GRCm39) unclassified probably benign
R7467:Nolc1 UTSW 19 46,070,773 (GRCm39) missense unknown
R7497:Nolc1 UTSW 19 46,071,257 (GRCm39) missense probably benign 0.23
R8011:Nolc1 UTSW 19 46,070,023 (GRCm39) missense unknown
R8806:Nolc1 UTSW 19 46,071,471 (GRCm39) missense unknown
RF027:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF031:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF034:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF040:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF044:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
X0050:Nolc1 UTSW 19 46,069,791 (GRCm39) small deletion probably benign
Y5377:Nolc1 UTSW 19 46,069,808 (GRCm39) small insertion probably benign
Y5379:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
Z1088:Nolc1 UTSW 19 46,071,537 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCACCGGATTGTCTTCTGTGCAATG -3'
(R):5'- AGTTGGTAGATCCACGCTGGCTTC -3'

Sequencing Primer
(F):5'- GATTGTCTTCTGTGCAATGACCTC -3'
(R):5'- AGTGCCAGTCTCCCAAAATC -3'
Posted On 2013-06-12