Mutagenetix > Incidental Mutation

Incidental Mutation 'R5997:Krt8'

480653

Institutional Source

Beutler Lab

Gene Symbol

Krt8

Ensembl Gene

ENSMUSG00000049382

Gene Name

keratin 8

Synonyms

Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2

MMRRC Submission

044176-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5997 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101996698-102004482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102000594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 200 (V200I)

Ref Sequence

ENSEMBL: ENSMUSP00000023952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023952]

AlphaFold

P11679

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023952
AA Change: V200I

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: V200I

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	1	93	9.4e-18	PFAM
Filament	96	407	7.82e-188	SMART
low complexity region	421	438	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230247

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.1%
20x: 90.5%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,373	D38V	probably benign	Het
Abcb9	A	T	5: 124,089,815	V121E	possibly damaging	Het
Adamts20	T	A	15: 94,379,747	Y278F	probably damaging	Het
Adcy7	A	T	8: 88,326,392	D972V	probably benign	Het
Adgrf3	C	A	5: 30,198,362		probably null	Het
Ahdc1	G	T	4: 133,063,895	G816C	probably benign	Het
Aifm3	A	G	16: 17,502,130	K283E	probably benign	Het
Akap6	T	C	12: 52,937,233		probably null	Het
Ank1	T	C	8: 23,099,662	L593P	probably damaging	Het
Apol11b	T	A	15: 77,635,497	T128S	probably benign	Het
C1qtnf7	C	A	5: 43,616,085	T235K	probably damaging	Het
Camk2a	A	T	18: 60,977,957	I73F	probably damaging	Het
Cd109	G	T	9: 78,705,062	V1244F	possibly damaging	Het
Cep164	A	G	9: 45,769,463	L1240S	possibly damaging	Het
Cnga1	T	A	5: 72,604,575	D532V	probably damaging	Het
Cyp4a14	A	T	4: 115,496,100	L5*	probably null	Het
Cyp4a30b	A	T	4: 115,459,391	K405*	probably null	Het
Dchs1	T	C	7: 105,754,095	D3080G	probably benign	Het
Ddx1	T	C	12: 13,237,799	D168G	probably damaging	Het
Dhx57	T	G	17: 80,245,806	K1231Q	probably damaging	Het
Dnah14	A	G	1: 181,770,105	N3640D	probably benign	Het
Dock4	T	A	12: 40,755,834	L935Q	probably damaging	Het
Dus2	A	T	8: 106,046,066	R269S	probably benign	Het
E230025N22Rik	G	A	18: 36,689,108	R201C	possibly damaging	Het
Erbb3	G	A	10: 128,583,185	T269M	probably damaging	Het
Fam71f2	T	A	6: 29,290,424	L267*	probably null	Het
Fbxo43	T	C	15: 36,162,093	R323G	probably damaging	Het
Fktn	A	G	4: 53,735,061	H233R	probably benign	Het
Ftsj3	A	T	11: 106,252,251	D412E	probably damaging	Het
Fzd7	A	T	1: 59,484,544	M529L	probably benign	Het
Fzr1	T	A	10: 81,370,826		probably null	Het
Ganc	T	G	2: 120,430,605	V257G	possibly damaging	Het
Gm4131	T	C	14: 62,464,758	K254E	probably damaging	Het
Gm6583	C	T	5: 112,355,008	V277M	possibly damaging	Het
Gm7347	G	T	5: 26,057,249	Y91*	probably null	Het
Gm9857	G	A	3: 108,940,165		probably benign	Het
Grpel1	T	C	5: 36,465,248	S19P	probably benign	Het
Gtf3c4	T	C	2: 28,833,711	K670E	possibly damaging	Het
Hist1h2bf	G	A	13: 23,574,103		probably benign	Het
Hmcn1	G	T	1: 150,704,173	Q1938K	possibly damaging	Het
Hnrnpk	T	C	13: 58,399,157	D71G	probably damaging	Het
Hspa4l	G	A	3: 40,767,979	R311H	probably damaging	Het
Igkv3-5	T	A	6: 70,663,704	F56L	probably benign	Het
Igkv6-20	T	A	6: 70,335,914	T92S	possibly damaging	Het
Lamb2	A	T	9: 108,480,388	T66S	possibly damaging	Het
Lamp3	A	G	16: 19,701,028	L135S	probably benign	Het
Lrguk	A	G	6: 34,129,143	Y701C	probably damaging	Het
Mcc	G	T	18: 44,449,321	L588M	probably damaging	Het
Mcidas	T	A	13: 112,998,586	L234Q	probably damaging	Het
Mtmr14	T	A	6: 113,280,614	L208Q	probably damaging	Het
Myof	A	G	19: 37,905,299	F1139L	possibly damaging	Het
Nlrp14	C	A	7: 107,182,496	T300K	probably benign	Het
Olfr1474	A	G	19: 13,471,506	I179V	probably benign	Het
Olfr165	T	A	16: 19,407,944	H24L	probably benign	Het
Olfr716	A	T	7: 107,147,328	E4V	possibly damaging	Het
Olfr890	A	T	9: 38,143,801	Y217F	probably damaging	Het
Orc2	A	G	1: 58,472,388	I354T	probably damaging	Het
Pard3b	G	T	1: 62,076,409	S140I	probably damaging	Het
Pcgf5	A	G	19: 36,434,603	D49G	probably benign	Het
Pcsk6	T	C	7: 65,959,293	F388S	probably damaging	Het
Prokr2	A	C	2: 132,381,442	I60S	probably damaging	Het
Rab33b	A	G	3: 51,484,479	T50A	possibly damaging	Het
Rbms3	T	C	9: 116,719,389	D61G	probably damaging	Het
Rhcg	T	A	7: 79,600,514	K274*	probably null	Het
Rnf112	C	T	11: 61,451,022	V319M	possibly damaging	Het
Rnf44	A	T	13: 54,682,800	S265T	possibly damaging	Het
Sf3a3	A	G	4: 124,722,058	D168G	probably damaging	Het
Sik2	A	G	9: 50,895,342		probably null	Het
Slco1a5	T	A	6: 142,253,113	L275F	probably benign	Het
Smtnl1	T	C	2: 84,815,378	H383R	probably damaging	Het
Spns3	T	G	11: 72,539,078	T175P	probably damaging	Het
Togaram1	A	G	12: 64,995,538	T1174A	probably benign	Het
Tradd	C	T	8: 105,260,645	E10K	possibly damaging	Het
Ttc7b	A	T	12: 100,373,560	Y579N	probably damaging	Het
Uncx	G	A	5: 139,547,589	G470R	probably damaging	Het
Vav3	T	A	3: 109,501,461	M177K	probably damaging	Het
Wfs1	A	T	5: 36,967,750	I599N	probably damaging	Het
Zfp454	G	A	11: 50,873,622	H217Y	probably damaging	Het

Other mutations in Krt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Krt8	APN	15	101998025	missense	probably benign
IGL01643:Krt8	APN	15	101997073	missense	possibly damaging	0.64
IGL01966:Krt8	APN	15	101997670	missense	probably benign	0.08
IGL02587:Krt8	APN	15	101998932	missense	probably benign	0.04
IGL03088:Krt8	APN	15	102000587	missense	possibly damaging	0.90
R0531:Krt8	UTSW	15	102001448	missense	probably benign	0.12
R1451:Krt8	UTSW	15	101998829	missense	possibly damaging	0.93
R2258:Krt8	UTSW	15	101998822	missense	probably benign
R2348:Krt8	UTSW	15	101998865	missense	probably benign	0.31
R2566:Krt8	UTSW	15	101998024	missense	probably benign	0.03
R3796:Krt8	UTSW	15	101999442	missense	probably benign	0.00
R4834:Krt8	UTSW	15	101998821	missense	probably damaging	1.00
R4965:Krt8	UTSW	15	101996951	missense	probably benign
R5212:Krt8	UTSW	15	101997967	missense	possibly damaging	0.52
R5249:Krt8	UTSW	15	101998440	missense	possibly damaging	0.69
R5419:Krt8	UTSW	15	102003902	missense	probably damaging	0.98
R5778:Krt8	UTSW	15	102003939	missense	probably damaging	0.99
R6503:Krt8	UTSW	15	101997934	missense	possibly damaging	0.66
R6683:Krt8	UTSW	15	101998004	missense	probably benign
R6812:Krt8	UTSW	15	101997979	missense	probably damaging	0.99
R6824:Krt8	UTSW	15	101998440	missense	possibly damaging	0.50
R6875:Krt8	UTSW	15	101997908	missense	probably benign	0.44
R7650:Krt8	UTSW	15	102004163	missense	probably benign	0.07
R8047:Krt8	UTSW	15	102003971	missense	probably damaging	0.99
R8559:Krt8	UTSW	15	102001544	missense	probably benign	0.03
R8826:Krt8	UTSW	15	102001435	missense	possibly damaging	0.89
R9146:Krt8	UTSW	15	101998935	missense	probably damaging	0.98
R9565:Krt8	UTSW	15	102004025	missense	probably benign	0.26
Z1177:Krt8	UTSW	15	101999435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATATAGGTGTCTCCTCCTGTG -3'
(R):5'- AGGATTGTCTCTCTTTGTGCAC -3'

Sequencing Primer
(F):5'- GTCTCCTGTGTCTCAGAGGC -3'
(R):5'- CACATTTCGCATGTACAAAGCCTTG -3'

Posted On

2017-06-26