Incidental Mutation 'R5998:Pigt'
ID480666
Institutional Source Beutler Lab
Gene Symbol Pigt
Ensembl Gene ENSMUSG00000017721
Gene Namephosphatidylinositol glycan anchor biosynthesis, class T
Synonyms2510012P17Rik, 4930534E15Rik, NDAP, Ndap7, CGI-06
MMRRC Submission 044177-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R5998 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164497520-164508301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164507454 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 559 (E559G)
Ref Sequence ENSEMBL: ENSMUSP00000099390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103101] [ENSMUST00000117066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103101
AA Change: E559G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099390
Gene: ENSMUSG00000017721
AA Change: E559G

DomainStartEndE-ValueType
Pfam:Gpi16 22 576 4.9e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117066
SMART Domains Protein: ENSMUSP00000112577
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 11 419 4.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138038
Predicted Effect probably benign
Transcript: ENSMUST00000152522
SMART Domains Protein: ENSMUSP00000115362
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 21 134 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null mutation do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,567,708 V4437I probably damaging Het
Acot12 T C 13: 91,757,534 I71T possibly damaging Het
Adcy10 A G 1: 165,541,649 I630V probably benign Het
Adcy3 T A 12: 4,198,348 V470E probably damaging Het
Adcy6 C A 15: 98,594,354 E1008* probably null Het
Adgrb3 A T 1: 25,431,501 probably null Het
Ahrr T A 13: 74,213,836 S515C probably damaging Het
Ankrd52 T C 10: 128,383,123 I416T probably damaging Het
Arhgap45 T C 10: 80,030,950 S1096P probably damaging Het
Atp8b4 A G 2: 126,433,867 probably null Het
Bcl6b A C 11: 70,228,183 I200M probably damaging Het
Btbd19 T A 4: 117,120,999 E234V probably benign Het
Csmd1 G A 8: 15,910,443 T3324I probably damaging Het
Cyp2a5 G A 7: 26,837,153 V186I probably benign Het
Glb1l2 G A 9: 26,766,003 T533I possibly damaging Het
Gm10471 T C 5: 26,084,706 D241G probably damaging Het
Gm8994 T C 6: 136,328,624 F28L probably benign Het
Helz G T 11: 107,685,534 E1851* probably null Het
Igkv15-103 T A 6: 68,437,505 F13Y unknown Het
Kcnq2 T C 2: 181,087,008 H548R probably damaging Het
Mcm3ap T C 10: 76,481,142 probably null Het
Micall2 T C 5: 139,706,911 probably null Het
Mill2 A G 7: 18,840,064 R25G probably benign Het
Mtcl1 G A 17: 66,368,280 H1041Y probably damaging Het
Olfr180 T C 16: 58,916,630 T4A probably benign Het
Olfr926 G A 9: 38,877,869 R231H probably damaging Het
Pkdrej A G 15: 85,815,453 V2094A probably benign Het
Ppp1r32 A T 19: 10,481,352 W105R possibly damaging Het
Prkdc T A 16: 15,783,157 L2894Q probably damaging Het
Tmem63b A G 17: 45,670,000 V256A possibly damaging Het
Zfp516 T C 18: 82,956,514 L279P probably damaging Het
Zfp780b T A 7: 27,964,622 K169N probably benign Het
Other mutations in Pigt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03076:Pigt APN 2 164497665 missense probably damaging 1.00
R1548:Pigt UTSW 2 164501519 missense probably benign 0.37
R1551:Pigt UTSW 2 164507403 missense probably damaging 0.99
R1605:Pigt UTSW 2 164507499 missense probably damaging 1.00
R3712:Pigt UTSW 2 164501645 missense probably benign 0.00
R3848:Pigt UTSW 2 164498580 critical splice donor site probably benign
R4672:Pigt UTSW 2 164497578 unclassified probably benign
R4719:Pigt UTSW 2 164501624 missense probably damaging 0.98
R5481:Pigt UTSW 2 164506422 missense probably damaging 1.00
R5567:Pigt UTSW 2 164501562 nonsense probably null
R5570:Pigt UTSW 2 164501562 nonsense probably null
R6112:Pigt UTSW 2 164506445 nonsense probably null
R6816:Pigt UTSW 2 164501132 missense probably damaging 1.00
R6889:Pigt UTSW 2 164507331 missense probably damaging 1.00
R7019:Pigt UTSW 2 164499669 frame shift probably null
R7037:Pigt UTSW 2 164499669 frame shift probably null
R7197:Pigt UTSW 2 164502516 missense probably damaging 1.00
R7288:Pigt UTSW 2 164499669 frame shift probably null
R7449:Pigt UTSW 2 164502499 missense probably damaging 1.00
R7822:Pigt UTSW 2 164499669 frame shift probably null
R8005:Pigt UTSW 2 164499669 frame shift probably null
R8019:Pigt UTSW 2 164499669 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGATGGCTCCAGCTACTTTG -3'
(R):5'- GCTAACTCTGGAGACACAGC -3'

Sequencing Primer
(F):5'- AGCTACTTTGTCCGACTCTACACAG -3'
(R):5'- ACGGGCTCACAGGACTAG -3'
Posted On2017-06-26