Incidental Mutation 'R5998:Mill2'
ID480673
Institutional Source Beutler Lab
Gene Symbol Mill2
Ensembl Gene ENSMUSG00000040987
Gene NameMHC I like leukocyte 2
Synonyms
MMRRC Submission 044177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5998 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18839966-18865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18840064 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 25 (R25G)
Ref Sequence ENSEMBL: ENSMUSP00000154222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072386] [ENSMUST00000072415] [ENSMUST00000206487] [ENSMUST00000227379] [ENSMUST00000228493]
Predicted Effect unknown
Transcript: ENSMUST00000072386
AA Change: R25G
SMART Domains Protein: ENSMUSP00000072223
Gene: ENSMUSG00000040987
AA Change: R25G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I_3 39 224 2.5e-14 PFAM
Pfam:MHC_I 49 225 1.5e-33 PFAM
IGc1 244 316 7.82e-6 SMART
low complexity region 332 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072415
AA Change: R25G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072246
Gene: ENSMUSG00000040987
AA Change: R25G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I 34 210 5.9e-33 PFAM
IGc1 229 301 7.82e-6 SMART
low complexity region 317 339 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206487
AA Change: R25G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207014
Predicted Effect probably benign
Transcript: ENSMUST00000227379
AA Change: R25G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000228493
AA Change: R25G
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,567,708 V4437I probably damaging Het
Acot12 T C 13: 91,757,534 I71T possibly damaging Het
Adcy10 A G 1: 165,541,649 I630V probably benign Het
Adcy3 T A 12: 4,198,348 V470E probably damaging Het
Adcy6 C A 15: 98,594,354 E1008* probably null Het
Adgrb3 A T 1: 25,431,501 probably null Het
Ahrr T A 13: 74,213,836 S515C probably damaging Het
Ankrd52 T C 10: 128,383,123 I416T probably damaging Het
Arhgap45 T C 10: 80,030,950 S1096P probably damaging Het
Atp8b4 A G 2: 126,433,867 probably null Het
Bcl6b A C 11: 70,228,183 I200M probably damaging Het
Btbd19 T A 4: 117,120,999 E234V probably benign Het
Csmd1 G A 8: 15,910,443 T3324I probably damaging Het
Cyp2a5 G A 7: 26,837,153 V186I probably benign Het
Glb1l2 G A 9: 26,766,003 T533I possibly damaging Het
Gm10471 T C 5: 26,084,706 D241G probably damaging Het
Gm8994 T C 6: 136,328,624 F28L probably benign Het
Helz G T 11: 107,685,534 E1851* probably null Het
Igkv15-103 T A 6: 68,437,505 F13Y unknown Het
Kcnq2 T C 2: 181,087,008 H548R probably damaging Het
Mcm3ap T C 10: 76,481,142 probably null Het
Micall2 T C 5: 139,706,911 probably null Het
Mtcl1 G A 17: 66,368,280 H1041Y probably damaging Het
Olfr180 T C 16: 58,916,630 T4A probably benign Het
Olfr926 G A 9: 38,877,869 R231H probably damaging Het
Pigt A G 2: 164,507,454 E559G possibly damaging Het
Pkdrej A G 15: 85,815,453 V2094A probably benign Het
Ppp1r32 A T 19: 10,481,352 W105R possibly damaging Het
Prkdc T A 16: 15,783,157 L2894Q probably damaging Het
Tmem63b A G 17: 45,670,000 V256A possibly damaging Het
Zfp516 T C 18: 82,956,514 L279P probably damaging Het
Zfp780b T A 7: 27,964,622 K169N probably benign Het
Other mutations in Mill2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Mill2 APN 7 18856640 missense probably damaging 0.98
IGL02465:Mill2 APN 7 18858243 nonsense probably null
IGL02876:Mill2 APN 7 18856507 missense probably damaging 1.00
R1725:Mill2 UTSW 7 18840068 missense probably benign 0.04
R1945:Mill2 UTSW 7 18841494 missense probably benign 0.00
R1964:Mill2 UTSW 7 18856604 missense probably damaging 1.00
R2260:Mill2 UTSW 7 18856488 missense probably benign 0.14
R3160:Mill2 UTSW 7 18856174 missense probably benign 0.32
R3162:Mill2 UTSW 7 18856174 missense probably benign 0.32
R4302:Mill2 UTSW 7 18856531 missense probably damaging 0.98
R4946:Mill2 UTSW 7 18856683 critical splice donor site probably null
R5121:Mill2 UTSW 7 18856666 missense probably benign 0.39
R5365:Mill2 UTSW 7 18858414 missense probably benign 0.01
R5557:Mill2 UTSW 7 18855959 nonsense probably null
R5736:Mill2 UTSW 7 18858249 missense probably benign 0.01
R6004:Mill2 UTSW 7 18856538 missense probably benign 0.32
R6016:Mill2 UTSW 7 18856448 missense probably benign 0.45
R6045:Mill2 UTSW 7 18856564 missense probably benign 0.01
R6534:Mill2 UTSW 7 18856596 missense possibly damaging 0.91
R6913:Mill2 UTSW 7 18856426 missense probably null 1.00
R7386:Mill2 UTSW 7 18858290 missense probably benign 0.16
Z1088:Mill2 UTSW 7 18856399 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACATTCAGATGTGAGTAACTCATC -3'
(R):5'- AAGCCTTCCTCCAGTTTCAG -3'

Sequencing Primer
(F):5'- GCAGATCTCTGGTCTACAAAGTG -3'
(R):5'- TGAATTTTCCAGCCCAGGG -3'
Posted On2017-06-26