Incidental Mutation 'R5998:Cyp2a5'
ID480674
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 5
SynonymsCoh
MMRRC Submission 044177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5998 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26835305-26843548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26837153 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 186 (V186I)
Ref Sequence ENSEMBL: ENSMUSP00000005685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
Predicted Effect probably benign
Transcript: ENSMUST00000005685
AA Change: V186I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547
AA Change: V186I

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165641
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169007
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170631
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,567,708 V4437I probably damaging Het
Acot12 T C 13: 91,757,534 I71T possibly damaging Het
Adcy10 A G 1: 165,541,649 I630V probably benign Het
Adcy3 T A 12: 4,198,348 V470E probably damaging Het
Adcy6 C A 15: 98,594,354 E1008* probably null Het
Adgrb3 A T 1: 25,431,501 probably null Het
Ahrr T A 13: 74,213,836 S515C probably damaging Het
Ankrd52 T C 10: 128,383,123 I416T probably damaging Het
Arhgap45 T C 10: 80,030,950 S1096P probably damaging Het
Atp8b4 A G 2: 126,433,867 probably null Het
Bcl6b A C 11: 70,228,183 I200M probably damaging Het
Btbd19 T A 4: 117,120,999 E234V probably benign Het
Csmd1 G A 8: 15,910,443 T3324I probably damaging Het
Glb1l2 G A 9: 26,766,003 T533I possibly damaging Het
Gm10471 T C 5: 26,084,706 D241G probably damaging Het
Gm8994 T C 6: 136,328,624 F28L probably benign Het
Helz G T 11: 107,685,534 E1851* probably null Het
Igkv15-103 T A 6: 68,437,505 F13Y unknown Het
Kcnq2 T C 2: 181,087,008 H548R probably damaging Het
Mcm3ap T C 10: 76,481,142 probably null Het
Micall2 T C 5: 139,706,911 probably null Het
Mill2 A G 7: 18,840,064 R25G probably benign Het
Mtcl1 G A 17: 66,368,280 H1041Y probably damaging Het
Olfr180 T C 16: 58,916,630 T4A probably benign Het
Olfr926 G A 9: 38,877,869 R231H probably damaging Het
Pigt A G 2: 164,507,454 E559G possibly damaging Het
Pkdrej A G 15: 85,815,453 V2094A probably benign Het
Ppp1r32 A T 19: 10,481,352 W105R possibly damaging Het
Prkdc T A 16: 15,783,157 L2894Q probably damaging Het
Tmem63b A G 17: 45,670,000 V256A possibly damaging Het
Zfp516 T C 18: 82,956,514 L279P probably damaging Het
Zfp780b T A 7: 27,964,622 K169N probably benign Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26837103 missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26841009 missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26843046 missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26835874 missense probably damaging 0.99
PIT4696001:Cyp2a5 UTSW 7 26840979 missense probably benign 0.18
R0762:Cyp2a5 UTSW 7 26838873 nonsense probably null
R0980:Cyp2a5 UTSW 7 26839006 splice site probably null
R1078:Cyp2a5 UTSW 7 26835541 missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26835936 missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26841876 intron probably benign
R1803:Cyp2a5 UTSW 7 26835546 splice site probably null
R1899:Cyp2a5 UTSW 7 26839033 nonsense probably null
R1977:Cyp2a5 UTSW 7 26835922 missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26840475 missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26837103 missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3052:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26841054 missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26835545 critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26841104 missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26835874 missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26842958 missense probably benign 0.09
R6186:Cyp2a5 UTSW 7 26843388 unclassified probably benign
R7338:Cyp2a5 UTSW 7 26842947 missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26836783 missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26840478 missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26837118 missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
R7983:Cyp2a5 UTSW 7 26840441 missense probably benign 0.40
R8805:Cyp2a5 UTSW 7 26841105 missense probably damaging 0.99
Z1088:Cyp2a5 UTSW 7 26841107 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26835497 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26836774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGCTCAGCACTCTAGCC -3'
(R):5'- TTGTTCTTGAGCAACCTGTAGAG -3'

Sequencing Primer
(F):5'- CAGGCGATGCTTTTTGC -3'
(R):5'- CTTGAGCAACCTGTAGAGATAGTTTG -3'
Posted On2017-06-26