Incidental Mutation 'R5998:Mcm3ap'
ID 480679
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Name minichromosome maintenance complex component 3 associated protein
Synonyms GANP
MMRRC Submission 044177-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 76468927-76515857 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 76481142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170795]
AlphaFold Q9WUU9
Predicted Effect probably null
Transcript: ENSMUST00000170795
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220410
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,567,708 V4437I probably damaging Het
Acot12 T C 13: 91,757,534 I71T possibly damaging Het
Adcy10 A G 1: 165,541,649 I630V probably benign Het
Adcy3 T A 12: 4,198,348 V470E probably damaging Het
Adcy6 C A 15: 98,594,354 E1008* probably null Het
Adgrb3 A T 1: 25,431,501 probably null Het
Ahrr T A 13: 74,213,836 S515C probably damaging Het
Ankrd52 T C 10: 128,383,123 I416T probably damaging Het
Arhgap45 T C 10: 80,030,950 S1096P probably damaging Het
Atp8b4 A G 2: 126,433,867 probably null Het
Bcl6b A C 11: 70,228,183 I200M probably damaging Het
Btbd19 T A 4: 117,120,999 E234V probably benign Het
Csmd1 G A 8: 15,910,443 T3324I probably damaging Het
Cyp2a5 G A 7: 26,837,153 V186I probably benign Het
Glb1l2 G A 9: 26,766,003 T533I possibly damaging Het
Gm10471 T C 5: 26,084,706 D241G probably damaging Het
Gm8994 T C 6: 136,328,624 F28L probably benign Het
Helz G T 11: 107,685,534 E1851* probably null Het
Igkv15-103 T A 6: 68,437,505 F13Y unknown Het
Kcnq2 T C 2: 181,087,008 H548R probably damaging Het
Micall2 T C 5: 139,706,911 probably null Het
Mill2 A G 7: 18,840,064 R25G probably benign Het
Mtcl1 G A 17: 66,368,280 H1041Y probably damaging Het
Olfr180 T C 16: 58,916,630 T4A probably benign Het
Olfr926 G A 9: 38,877,869 R231H probably damaging Het
Pigt A G 2: 164,507,454 E559G possibly damaging Het
Pkdrej A G 15: 85,815,453 V2094A probably benign Het
Ppp1r32 A T 19: 10,481,352 W105R possibly damaging Het
Prkdc T A 16: 15,783,157 L2894Q probably damaging Het
Tmem63b A G 17: 45,670,000 V256A possibly damaging Het
Zfp516 T C 18: 82,956,514 L279P probably damaging Het
Zfp780b T A 7: 27,964,622 K169N probably benign Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
Bane UTSW 10 76483226 missense probably damaging 1.00
Doom UTSW 10 76501314 missense probably benign
woeful UTSW 10 76481015 missense probably benign 0.44
PIT4377001:Mcm3ap UTSW 10 76502762 missense possibly damaging 0.78
PIT4791001:Mcm3ap UTSW 10 76506473 missense probably damaging 1.00
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76481015 missense probably benign 0.44
R0423:Mcm3ap UTSW 10 76502705 missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76483226 missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76471160 missense probably benign
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76471166 missense probably benign
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R6122:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
R7212:Mcm3ap UTSW 10 76501311 missense probably benign 0.01
R7403:Mcm3ap UTSW 10 76482823 critical splice donor site probably null
R7470:Mcm3ap UTSW 10 76508397 missense probably damaging 1.00
R7561:Mcm3ap UTSW 10 76492878 missense possibly damaging 0.94
R7610:Mcm3ap UTSW 10 76496720 splice site probably null
R7620:Mcm3ap UTSW 10 76470433 missense probably benign 0.00
R7898:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R8266:Mcm3ap UTSW 10 76476580 nonsense probably null
R8355:Mcm3ap UTSW 10 76493501 missense probably benign 0.32
R8367:Mcm3ap UTSW 10 76477859 missense possibly damaging 0.65
R8867:Mcm3ap UTSW 10 76470704 missense probably benign 0.31
R9282:Mcm3ap UTSW 10 76506518 missense probably damaging 1.00
R9319:Mcm3ap UTSW 10 76482804 missense probably damaging 1.00
R9339:Mcm3ap UTSW 10 76470524 missense probably benign 0.04
R9554:Mcm3ap UTSW 10 76496476 missense probably damaging 0.97
R9706:Mcm3ap UTSW 10 76476518 missense probably damaging 1.00
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACGCACCCTTACGTTTG -3'
(R):5'- CCCTTCGACACATTCATTTAACAG -3'

Sequencing Primer
(F):5'- GGCTTGGTATCATTCAGCTCGAG -3'
(R):5'- ACAGATCTCTGAGTTTGAGTCCAGC -3'
Posted On 2017-06-26