Incidental Mutation 'R5998:Bcl6b'
ID480683
Institutional Source Beutler Lab
Gene Symbol Bcl6b
Ensembl Gene ENSMUSG00000000317
Gene NameB cell CLL/lymphoma 6, member B
SynonymsBazf
MMRRC Submission 044177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5998 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70224128-70229798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70228183 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 200 (I200M)
Ref Sequence ENSEMBL: ENSMUSP00000000326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000326] [ENSMUST00000153449]
Predicted Effect probably damaging
Transcript: ENSMUST00000000326
AA Change: I200M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000326
Gene: ENSMUSG00000000317
AA Change: I200M

DomainStartEndE-ValueType
BTB 38 135 2.17e-25 SMART
low complexity region 143 163 N/A INTRINSIC
ZnF_C2H2 323 345 4.11e-2 SMART
ZnF_C2H2 351 373 2.12e-4 SMART
ZnF_C2H2 379 401 8.34e-3 SMART
ZnF_C2H2 407 429 1.12e-3 SMART
ZnF_C2H2 435 458 1.33e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140542
Predicted Effect probably benign
Transcript: ENSMUST00000153449
SMART Domains Protein: ENSMUSP00000121365
Gene: ENSMUSG00000000317

DomainStartEndE-ValueType
BTB 38 116 2.14e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display decreased CD4+ and CD8+ cell numbers in the thymus. Homozygous mice for one null allele display decreased secondary responses of memory CD8+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,567,708 V4437I probably damaging Het
Acot12 T C 13: 91,757,534 I71T possibly damaging Het
Adcy10 A G 1: 165,541,649 I630V probably benign Het
Adcy3 T A 12: 4,198,348 V470E probably damaging Het
Adcy6 C A 15: 98,594,354 E1008* probably null Het
Adgrb3 A T 1: 25,431,501 probably null Het
Ahrr T A 13: 74,213,836 S515C probably damaging Het
Ankrd52 T C 10: 128,383,123 I416T probably damaging Het
Arhgap45 T C 10: 80,030,950 S1096P probably damaging Het
Atp8b4 A G 2: 126,433,867 probably null Het
Btbd19 T A 4: 117,120,999 E234V probably benign Het
Csmd1 G A 8: 15,910,443 T3324I probably damaging Het
Cyp2a5 G A 7: 26,837,153 V186I probably benign Het
Glb1l2 G A 9: 26,766,003 T533I possibly damaging Het
Gm10471 T C 5: 26,084,706 D241G probably damaging Het
Gm8994 T C 6: 136,328,624 F28L probably benign Het
Helz G T 11: 107,685,534 E1851* probably null Het
Igkv15-103 T A 6: 68,437,505 F13Y unknown Het
Kcnq2 T C 2: 181,087,008 H548R probably damaging Het
Mcm3ap T C 10: 76,481,142 probably null Het
Micall2 T C 5: 139,706,911 probably null Het
Mill2 A G 7: 18,840,064 R25G probably benign Het
Mtcl1 G A 17: 66,368,280 H1041Y probably damaging Het
Olfr180 T C 16: 58,916,630 T4A probably benign Het
Olfr926 G A 9: 38,877,869 R231H probably damaging Het
Pigt A G 2: 164,507,454 E559G possibly damaging Het
Pkdrej A G 15: 85,815,453 V2094A probably benign Het
Ppp1r32 A T 19: 10,481,352 W105R possibly damaging Het
Prkdc T A 16: 15,783,157 L2894Q probably damaging Het
Tmem63b A G 17: 45,670,000 V256A possibly damaging Het
Zfp516 T C 18: 82,956,514 L279P probably damaging Het
Zfp780b T A 7: 27,964,622 K169N probably benign Het
Other mutations in Bcl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Bcl6b APN 11 70228484 unclassified probably benign
IGL01942:Bcl6b APN 11 70226743 missense probably damaging 1.00
IGL02338:Bcl6b APN 11 70229092 missense probably damaging 1.00
IGL02725:Bcl6b APN 11 70228518 missense probably damaging 1.00
IGL02741:Bcl6b APN 11 70229116 missense probably damaging 0.99
R4407:Bcl6b UTSW 11 70226103 missense probably damaging 1.00
R5508:Bcl6b UTSW 11 70226093 missense probably damaging 1.00
R6257:Bcl6b UTSW 11 70226052 missense probably benign
R6600:Bcl6b UTSW 11 70229128 missense probably damaging 1.00
R7107:Bcl6b UTSW 11 70226570 missense probably damaging 1.00
R7896:Bcl6b UTSW 11 70227022 nonsense probably null
R7979:Bcl6b UTSW 11 70227022 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATGGCCTACTCAATGGCTC -3'
(R):5'- TCTAGGCATCTCCTTGCGAC -3'

Sequencing Primer
(F):5'- GTGGACCAGACTCTAAAACTCTTGG -3'
(R):5'- ATCTCCTTGCGACCTGTGGAG -3'
Posted On2017-06-26