Mutagenetix > Incidental Mutations

Incidental Mutation 'R5998:Adcy6'

480689

Institutional Source

Beutler Lab

Gene Symbol

Adcy6

Ensembl Gene

ENSMUSG00000022994

Gene Name

adenylate cyclase 6

Synonyms

MMRRC Submission

044177-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5998 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98589973-98610076 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 98594354 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1008 (E1008*)

Ref Sequence

ENSEMBL: ENSMUSP00000154421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023728] [ENSMUST00000096224] [ENSMUST00000228566] [ENSMUST00000228903]

Predicted Effect

probably benign
Transcript: ENSMUST00000023728

Predicted Effect

probably null
Transcript: ENSMUST00000096224
AA Change: E1010*

SMART Domains

Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: E1010*

Domain	Start	End	E-Value	Type
low complexity region	150	166	N/A	INTRINSIC
low complexity region	169	177	N/A	INTRINSIC
low complexity region	212	228	N/A	INTRINSIC
CYCc	331	532	2.95e-63	SMART
Pfam:DUF1053	580	669	3.5e-18	PFAM
transmembrane domain	701	723	N/A	INTRINSIC
transmembrane domain	744	763	N/A	INTRINSIC
transmembrane domain	815	834	N/A	INTRINSIC
transmembrane domain	839	861	N/A	INTRINSIC
Blast:CYCc	885	929	5e-20	BLAST
CYCc	939	1147	4.81e-45	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226236

Predicted Effect

probably null
Transcript: ENSMUST00000228566
AA Change: E1008*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228596

Predicted Effect

probably benign
Transcript: ENSMUST00000228903

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,567,708	V4437I	probably damaging	Het
Acot12	T	C	13: 91,757,534	I71T	possibly damaging	Het
Adcy10	A	G	1: 165,541,649	I630V	probably benign	Het
Adcy3	T	A	12: 4,198,348	V470E	probably damaging	Het
Adgrb3	A	T	1: 25,431,501		probably null	Het
Ahrr	T	A	13: 74,213,836	S515C	probably damaging	Het
Ankrd52	T	C	10: 128,383,123	I416T	probably damaging	Het
Arhgap45	T	C	10: 80,030,950	S1096P	probably damaging	Het
Atp8b4	A	G	2: 126,433,867		probably null	Het
Bcl6b	A	C	11: 70,228,183	I200M	probably damaging	Het
Btbd19	T	A	4: 117,120,999	E234V	probably benign	Het
Csmd1	G	A	8: 15,910,443	T3324I	probably damaging	Het
Cyp2a5	G	A	7: 26,837,153	V186I	probably benign	Het
Glb1l2	G	A	9: 26,766,003	T533I	possibly damaging	Het
Gm10471	T	C	5: 26,084,706	D241G	probably damaging	Het
Gm8994	T	C	6: 136,328,624	F28L	probably benign	Het
Helz	G	T	11: 107,685,534	E1851*	probably null	Het
Igkv15-103	T	A	6: 68,437,505	F13Y	unknown	Het
Kcnq2	T	C	2: 181,087,008	H548R	probably damaging	Het
Mcm3ap	T	C	10: 76,481,142		probably null	Het
Micall2	T	C	5: 139,706,911		probably null	Het
Mill2	A	G	7: 18,840,064	R25G	probably benign	Het
Mtcl1	G	A	17: 66,368,280	H1041Y	probably damaging	Het
Olfr180	T	C	16: 58,916,630	T4A	probably benign	Het
Olfr926	G	A	9: 38,877,869	R231H	probably damaging	Het
Pigt	A	G	2: 164,507,454	E559G	possibly damaging	Het
Pkdrej	A	G	15: 85,815,453	V2094A	probably benign	Het
Ppp1r32	A	T	19: 10,481,352	W105R	possibly damaging	Het
Prkdc	T	A	16: 15,783,157	L2894Q	probably damaging	Het
Tmem63b	A	G	17: 45,670,000	V256A	possibly damaging	Het
Zfp516	T	C	18: 82,956,514	L279P	probably damaging	Het
Zfp780b	T	A	7: 27,964,622	K169N	probably benign	Het

Other mutations in Adcy6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Adcy6	APN	15	98598976	missense	probably damaging	1.00
IGL01132:Adcy6	APN	15	98597851	missense	probably benign	0.14
IGL01642:Adcy6	APN	15	98594509	missense	possibly damaging	0.88
IGL01647:Adcy6	APN	15	98600275	missense	probably damaging	1.00
IGL01788:Adcy6	APN	15	98596519	nonsense	probably null
IGL02122:Adcy6	APN	15	98598882	missense	possibly damaging	0.66
IGL02210:Adcy6	APN	15	98594971	missense	possibly damaging	0.63
IGL02249:Adcy6	APN	15	98599914	missense	probably damaging	1.00
IGL02404:Adcy6	APN	15	98596938	missense	probably benign
IGL02691:Adcy6	APN	15	98604304	missense	probably damaging	1.00
PIT4515001:Adcy6	UTSW	15	98595146	missense	probably benign	0.04
R0178:Adcy6	UTSW	15	98604215	missense	probably benign	0.00
R0497:Adcy6	UTSW	15	98597725	critical splice donor site	probably null
R0739:Adcy6	UTSW	15	98598379	missense	probably benign	0.00
R1454:Adcy6	UTSW	15	98604728	missense	probably damaging	1.00
R1473:Adcy6	UTSW	15	98592743	missense	probably damaging	0.99
R1536:Adcy6	UTSW	15	98600007	missense	probably damaging	1.00
R1927:Adcy6	UTSW	15	98598498	splice site	probably null
R2178:Adcy6	UTSW	15	98594355	missense	probably damaging	1.00
R2294:Adcy6	UTSW	15	98597441	missense	possibly damaging	0.48
R2356:Adcy6	UTSW	15	98597016	splice site	probably null
R2898:Adcy6	UTSW	15	98593488	missense	probably damaging	1.00
R3001:Adcy6	UTSW	15	98596660	missense	probably benign	0.01
R3002:Adcy6	UTSW	15	98596660	missense	probably benign	0.01
R3794:Adcy6	UTSW	15	98598943	missense	probably damaging	1.00
R3884:Adcy6	UTSW	15	98597174	missense	probably benign	0.06
R4348:Adcy6	UTSW	15	98604160	missense	probably benign	0.44
R4351:Adcy6	UTSW	15	98604160	missense	probably benign	0.44
R4542:Adcy6	UTSW	15	98598988	missense	possibly damaging	0.70
R4548:Adcy6	UTSW	15	98598659	missense	probably damaging	1.00
R5693:Adcy6	UTSW	15	98603989	missense	probably damaging	1.00
R5707:Adcy6	UTSW	15	98598741	missense	probably damaging	1.00
R5994:Adcy6	UTSW	15	98593664	missense	probably damaging	1.00
R6142:Adcy6	UTSW	15	98598422	missense	probably benign
R6242:Adcy6	UTSW	15	98604015	nonsense	probably null
R6305:Adcy6	UTSW	15	98598645	missense	probably benign	0.13
R6751:Adcy6	UTSW	15	98596205	missense	probably benign
R7130:Adcy6	UTSW	15	98597229	missense	probably benign
R7335:Adcy6	UTSW	15	98603876	missense	probably benign	0.29
R7643:Adcy6	UTSW	15	98593568	missense	probably benign
R7658:Adcy6	UTSW	15	98596067	missense	probably benign	0.00
R7748:Adcy6	UTSW	15	98604556	missense	probably benign	0.01
R7761:Adcy6	UTSW	15	98600014	missense	probably damaging	1.00
R7774:Adcy6	UTSW	15	98596533	missense	probably benign
X0020:Adcy6	UTSW	15	98598735	missense	probably damaging	0.99
X0021:Adcy6	UTSW	15	98603942	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CGCATAGATTTGACTACTGTCTTC -3'
(R):5'- ATTCTTCCCAAGGACGTGGC -3'

Sequencing Primer
(F):5'- CATGCTGTCCCTGACTGG -3'
(R):5'- TGGCCGCCCACTTCCTG -3'

Posted On

2017-06-26