Mutagenetix > Incidental Mutations

Incidental Mutation 'R5999:Akp3'

480699

Institutional Source

Beutler Lab

Gene Symbol

Akp3

Ensembl Gene

ENSMUSG00000036500

Gene Name

alkaline phosphatase 3, intestine, not Mn requiring

Synonyms

Akp-3, IAP

MMRRC Submission

044178-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R5999 (G1)

Quality Score

174.009

Status

Validated

Chromosome

Chromosomal Location

87124973-87127912 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87127541 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 437 (Y437N)

Ref Sequence

ENSEMBL: ENSMUSP00000037497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044878]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044878
AA Change: Y437N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: Y437N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	33	45	N/A	INTRINSIC
alkPPc	53	487	1.92e-249	SMART
low complexity region	503	524	N/A	INTRINSIC
low complexity region	533	557	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187662

Meta Mutation Damage Score

0.4459

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 90.9%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,285,468	F1799L	probably damaging	Het
Acot5	A	G	12: 84,075,554	D304G	probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Aes	T	C	10: 81,561,264	S25P	probably damaging	Het
Akap9	A	G	5: 4,043,925	N2149S	probably damaging	Het
Anks1b	C	T	10: 90,359,048	T530I	probably damaging	Het
Bnc2	C	T	4: 84,555,900	R3H	probably benign	Het
Cald1	A	T	6: 34,746,338		probably benign	Het
Capn9	A	G	8: 124,589,078	T87A	probably damaging	Het
Ccdc88c	A	G	12: 100,968,354	L175P	probably damaging	Het
Cd226	T	C	18: 89,207,219	V80A	probably damaging	Het
Cd44	A	T	2: 102,845,397	N310K	probably benign	Het
Cenpc1	T	A	5: 86,012,263	K905N	probably damaging	Het
Cept1	A	T	3: 106,533,443	D133E	probably damaging	Het
Cltc	T	C	11: 86,704,129	H1381R	possibly damaging	Het
Col4a4	T	A	1: 82,492,619	T730S	unknown	Het
Col6a4	A	T	9: 106,067,921	M998K	probably benign	Het
Cpne6	T	C	14: 55,513,059	V119A	probably benign	Het
Ddx54	G	T	5: 120,623,580	A474S	probably benign	Het
Dmbx1	G	T	4: 115,918,176	N302K	probably damaging	Het
Dnah8	A	G	17: 30,663,305	E617G	probably benign	Het
Ei24	A	G	9: 36,793,307	V10A	probably benign	Het
Elp3	A	G	14: 65,531,540	V543A	probably benign	Het
Frmd3	T	C	4: 74,170,691	I375T	possibly damaging	Het
Gm6408	A	G	5: 146,484,257	D232G	possibly damaging	Het
Inmt	A	T	6: 55,174,948	Y12*	probably null	Het
Inpp5k	G	T	11: 75,633,100	A44S	probably damaging	Het
Kalrn	T	A	16: 34,357,343	T169S	probably damaging	Het
Kif28	A	T	1: 179,695,790	F992I	probably damaging	Het
Kmt2c	A	T	5: 25,284,205	Y1199N	probably damaging	Het
Large2	C	T	2: 92,366,058	E475K	probably benign	Het
Mroh2b	T	A	15: 4,912,884		probably null	Het
Mrpl42	T	C	10: 95,500,479		probably benign	Het
Muc5b	A	T	7: 141,857,379	H1354L	unknown	Het
Myof	C	A	19: 37,939,856	E1095*	probably null	Het
Ncor2	A	G	5: 125,033,441	V1385A	probably damaging	Het
Nr5a2	T	C	1: 136,845,542	Y474C	probably damaging	Het
Olfr1156	A	T	2: 87,949,801		probably null	Het
Olfr1438-ps1	C	T	19: 12,333,644	D71N	probably damaging	Het
Olfr338	A	G	2: 36,377,310	D178G	probably damaging	Het
Pogz	A	G	3: 94,856,117	T67A	possibly damaging	Het
Prep	T	A	10: 45,072,129		probably null	Het
Prf1	A	G	10: 61,303,028	D255G	probably damaging	Het
Psme2	A	G	14: 55,590,082	L24P	probably damaging	Het
Scmh1	T	A	4: 120,505,515		probably null	Het
Scpep1	A	G	11: 88,929,313	V383A	possibly damaging	Het
Slc4a10	A	T	2: 62,243,431	N279I	probably benign	Het
Sphkap	T	C	1: 83,267,405	S1498G	probably benign	Het
Spinkl	C	A	18: 44,168,139	S44I	probably damaging	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tmem213	A	G	6: 38,109,451	Q14R	probably benign	Het
Tns1	A	T	1: 73,928,097	Y1172*	probably null	Het
Ugt2b37	A	C	5: 87,254,177	I198M	probably benign	Het
Usp17lb	A	C	7: 104,840,345	I457M	probably damaging	Het
Usp6nl	G	T	2: 6,441,339	R709L	probably damaging	Het
Zer1	A	G	2: 30,104,997	L462P	probably damaging	Het
Zfhx2	A	G	14: 55,074,005	S411P	probably benign	Het

Other mutations in Akp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Akp3	APN	1	87127136	splice site	probably benign
IGL02146:Akp3	APN	1	87126575	missense	probably benign	0.00
IGL02216:Akp3	APN	1	87127650	missense	probably damaging	1.00
IGL02677:Akp3	APN	1	87125272	missense	probably damaging	1.00
IGL02716:Akp3	APN	1	87125479	missense	probably damaging	1.00
IGL02943:Akp3	APN	1	87126369	nonsense	probably null
IGL03099:Akp3	APN	1	87127606	missense	probably benign	0.14
R0458:Akp3	UTSW	1	87126537	nonsense	probably null
R0755:Akp3	UTSW	1	87127871	missense	unknown
R0783:Akp3	UTSW	1	87127871	missense	unknown
R0784:Akp3	UTSW	1	87127871	missense	unknown
R1080:Akp3	UTSW	1	87127001	missense	probably damaging	0.99
R1120:Akp3	UTSW	1	87125437	missense	probably damaging	0.98
R1128:Akp3	UTSW	1	87127871	missense	unknown
R1130:Akp3	UTSW	1	87127871	missense	unknown
R1175:Akp3	UTSW	1	87127871	missense	unknown
R1200:Akp3	UTSW	1	87125260	missense	probably damaging	1.00
R1618:Akp3	UTSW	1	87127871	missense	unknown
R1864:Akp3	UTSW	1	87127767	small deletion	probably benign
R2111:Akp3	UTSW	1	87126885	intron	probably null
R4657:Akp3	UTSW	1	87125834	intron	probably benign
R5278:Akp3	UTSW	1	87125166	missense	probably benign	0.01
R5563:Akp3	UTSW	1	87125924	missense	probably damaging	1.00
R5643:Akp3	UTSW	1	87127763	missense	unknown
R5768:Akp3	UTSW	1	87127122	missense	probably damaging	0.99
R5809:Akp3	UTSW	1	87126548	missense	probably benign	0.06
R5956:Akp3	UTSW	1	87126945	missense	probably damaging	1.00
R6945:Akp3	UTSW	1	87125631	missense	probably damaging	1.00
R7028:Akp3	UTSW	1	87126778	missense	probably benign
R7154:Akp3	UTSW	1	87125224	missense	probably damaging	0.99
R7162:Akp3	UTSW	1	87127749	missense	unknown
R7486:Akp3	UTSW	1	87125479	missense	probably damaging	1.00
R7825:Akp3	UTSW	1	87127767	small deletion	probably benign
X0018:Akp3	UTSW	1	87126338	missense	probably damaging	1.00
X0060:Akp3	UTSW	1	87125894	missense	probably damaging	1.00
X0066:Akp3	UTSW	1	87126796	missense	probably damaging	0.98
Z1177:Akp3	UTSW	1	87126445	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGGAAAACGTGTCCCTCTTC -3'
(R):5'- GTCTGGCTTTCATCTGCAGG -3'

Sequencing Primer
(F):5'- TCAATGCTCTGGACGGCAAG -3'
(R):5'- CTTTCATCTGCAGGGGGTG -3'

Posted On

2017-06-26