Incidental Mutation 'R5999:Akp3'
ID480699
Institutional Source Beutler Lab
Gene Symbol Akp3
Ensembl Gene ENSMUSG00000036500
Gene Namealkaline phosphatase 3, intestine, not Mn requiring
SynonymsAkp-3, IAP
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5999 (G1)
Quality Score174.009
Status Validated
Chromosome1
Chromosomal Location87124973-87127912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87127541 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 437 (Y437N)
Ref Sequence ENSEMBL: ENSMUSP00000037497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044878]
Predicted Effect probably damaging
Transcript: ENSMUST00000044878
AA Change: Y437N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: Y437N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 53 487 1.92e-249 SMART
low complexity region 503 524 N/A INTRINSIC
low complexity region 533 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187662
Meta Mutation Damage Score 0.4459 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Akp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Akp3 APN 1 87127136 splice site probably benign
IGL02146:Akp3 APN 1 87126575 missense probably benign 0.00
IGL02216:Akp3 APN 1 87127650 missense probably damaging 1.00
IGL02677:Akp3 APN 1 87125272 missense probably damaging 1.00
IGL02716:Akp3 APN 1 87125479 missense probably damaging 1.00
IGL02943:Akp3 APN 1 87126369 nonsense probably null
IGL03099:Akp3 APN 1 87127606 missense probably benign 0.14
R0458:Akp3 UTSW 1 87126537 nonsense probably null
R0755:Akp3 UTSW 1 87127871 missense unknown
R0783:Akp3 UTSW 1 87127871 missense unknown
R0784:Akp3 UTSW 1 87127871 missense unknown
R1080:Akp3 UTSW 1 87127001 missense probably damaging 0.99
R1120:Akp3 UTSW 1 87125437 missense probably damaging 0.98
R1128:Akp3 UTSW 1 87127871 missense unknown
R1130:Akp3 UTSW 1 87127871 missense unknown
R1175:Akp3 UTSW 1 87127871 missense unknown
R1200:Akp3 UTSW 1 87125260 missense probably damaging 1.00
R1618:Akp3 UTSW 1 87127871 missense unknown
R1864:Akp3 UTSW 1 87127767 small deletion probably benign
R2111:Akp3 UTSW 1 87126885 intron probably null
R4657:Akp3 UTSW 1 87125834 intron probably benign
R5278:Akp3 UTSW 1 87125166 missense probably benign 0.01
R5563:Akp3 UTSW 1 87125924 missense probably damaging 1.00
R5643:Akp3 UTSW 1 87127763 missense unknown
R5768:Akp3 UTSW 1 87127122 missense probably damaging 0.99
R5809:Akp3 UTSW 1 87126548 missense probably benign 0.06
R5956:Akp3 UTSW 1 87126945 missense probably damaging 1.00
R6945:Akp3 UTSW 1 87125631 missense probably damaging 1.00
R7028:Akp3 UTSW 1 87126778 missense probably benign
R7154:Akp3 UTSW 1 87125224 missense probably damaging 0.99
R7162:Akp3 UTSW 1 87127749 missense unknown
R7486:Akp3 UTSW 1 87125479 missense probably damaging 1.00
R7825:Akp3 UTSW 1 87127767 small deletion probably benign
X0018:Akp3 UTSW 1 87126338 missense probably damaging 1.00
X0060:Akp3 UTSW 1 87125894 missense probably damaging 1.00
X0066:Akp3 UTSW 1 87126796 missense probably damaging 0.98
Z1177:Akp3 UTSW 1 87126445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGGAAAACGTGTCCCTCTTC -3'
(R):5'- GTCTGGCTTTCATCTGCAGG -3'

Sequencing Primer
(F):5'- TCAATGCTCTGGACGGCAAG -3'
(R):5'- CTTTCATCTGCAGGGGGTG -3'
Posted On2017-06-26