Incidental Mutation 'R5999:Olfr1156'
ID480706
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Nameolfactory receptor 1156
SynonymsMOR174-3, GA_x6K02T2Q125-49433499-49432537
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5999 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87947053-87953100 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 87949801 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099842
AA Change: L144Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: L144Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215903
Predicted Effect possibly damaging
Transcript: ENSMUST00000216191
AA Change: L144Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216726
AA Change: L144Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.9264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 unclassified probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0926:Olfr1156 UTSW 2 87949922 missense probably damaging 1.00
R0987:Olfr1156 UTSW 2 87949547 missense probably benign 0.12
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3872:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R4526:Olfr1156 UTSW 2 87949409 missense probably benign 0.09
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
R7970:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGCTTTGCGTCTCCCC -3'
(R):5'- TTGTGCCAAAGATGTTCACTG -3'

Sequencing Primer
(F):5'- GCAGAGCGCATCTTCAGG -3'
(R):5'- GATGTTCACTGATATTATCAACCAGG -3'
Posted On2017-06-26