Incidental Mutation 'R0514:Tpr'
ID48071
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission 038708-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0514 (G1)
Quality Score219
Status Not validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150402273 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 117 (K117E)
Ref Sequence ENSEMBL: ENSMUSP00000112606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: K117E

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: K117E

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: K191E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: K191E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Acsl6 A T 11: 54,350,580 D579V probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dhx34 T C 7: 16,210,537 Q584R probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dnah5 A G 15: 28,366,321 T2727A probably damaging Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Parg C A 14: 32,254,560 T186K possibly damaging Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Plch2 A G 4: 154,998,886 S431P probably damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Prr5 A G 15: 84,702,766 N248S probably benign Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
gridiron UTSW 1 150423516 missense probably damaging 1.00
Pouch UTSW 1 150433772 missense probably damaging 1.00
punt UTSW 1 150418039 missense probably benign 0.02
Turf UTSW 1 150442245 critical splice donor site probably null
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 splice site probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7973:Tpr UTSW 1 150403887 missense probably damaging 1.00
R8013:Tpr UTSW 1 150398608 missense probably benign
R8220:Tpr UTSW 1 150432413 missense probably benign 0.05
R8274:Tpr UTSW 1 150423479 splice site probably benign
R8428:Tpr UTSW 1 150414813 missense probably damaging 1.00
R8482:Tpr UTSW 1 150433700 missense probably damaging 1.00
R8699:Tpr UTSW 1 150418021 missense probably damaging 0.99
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCAAACACAAATGTGTGATAGTTCCC -3'
(R):5'- ACACTTGCTCCcacttatgaactcact -3'

Sequencing Primer
(F):5'- GAGTGACATGCATTCATAAGCC -3'
(R):5'- tccacaatgcttacctatccc -3'
Posted On2013-06-12