Incidental Mutation 'R5999:Cept1'
ID480710
Institutional Source Beutler Lab
Gene Symbol Cept1
Ensembl Gene ENSMUSG00000040774
Gene Namecholine/ethanolaminephosphotransferase 1
Synonyms9930118K05Rik
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5999 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location106502260-106547802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106533443 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 133 (D133E)
Ref Sequence ENSEMBL: ENSMUSP00000142097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039153] [ENSMUST00000068301] [ENSMUST00000121231] [ENSMUST00000137530] [ENSMUST00000148269] [ENSMUST00000192438]
Predicted Effect probably damaging
Transcript: ENSMUST00000039153
AA Change: D133E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037277
Gene: ENSMUSG00000040774
AA Change: D133E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 229 6.4e-23 PFAM
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 281 303 N/A INTRINSIC
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068301
AA Change: D133E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065743
Gene: ENSMUSG00000040774
AA Change: D133E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 328 3.2e-21 PFAM
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121231
AA Change: D133E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112509
Gene: ENSMUSG00000040774
AA Change: D133E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 83 158 7.4e-18 PFAM
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137530
AA Change: M49K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115898
Gene: ENSMUSG00000040774
AA Change: M49K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148269
AA Change: D133E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118343
Gene: ENSMUSG00000040774
AA Change: D133E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 178 8.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192438
AA Change: D133E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142097
Gene: ENSMUSG00000040774
AA Change: D133E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 215 2.3e-20 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Meta Mutation Damage Score 0.9327 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene codes for a choline/ethanolaminephosphotransferase, which functions in the synthesis of choline- or ethanolamine- containing phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Conditional homozygous knockout in skeletal muscle leads to improved glucose tolerance, increased insulin sensitivity and muscle weakness in mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Cept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cept1 APN 3 106505803 missense possibly damaging 0.95
IGL01860:Cept1 APN 3 106531128 intron probably benign
IGL02053:Cept1 APN 3 106533396 missense probably damaging 1.00
IGL02351:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02358:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02568:Cept1 APN 3 106503719 missense probably benign 0.03
IGL02960:Cept1 APN 3 106539396 nonsense probably null
IGL03019:Cept1 APN 3 106504641 missense probably damaging 1.00
IGL03182:Cept1 APN 3 106504550 missense probably damaging 1.00
IGL03401:Cept1 APN 3 106533390 missense probably damaging 1.00
R2128:Cept1 UTSW 3 106512879 missense probably damaging 1.00
R2928:Cept1 UTSW 3 106531152 missense probably benign 0.07
R3688:Cept1 UTSW 3 106520015 missense probably benign 0.00
R4762:Cept1 UTSW 3 106539361 nonsense probably null
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4890:Cept1 UTSW 3 106505807 missense probably damaging 1.00
R5506:Cept1 UTSW 3 106531248 missense probably benign 0.00
R6106:Cept1 UTSW 3 106503676 missense probably benign 0.00
R6478:Cept1 UTSW 3 106533445 nonsense probably null
R6560:Cept1 UTSW 3 106505278 missense possibly damaging 0.84
R6858:Cept1 UTSW 3 106512879 splice site probably null
R7372:Cept1 UTSW 3 106503740 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCATTAACCAGAACCATGAGTC -3'
(R):5'- TCTTCCACAGCTTTCAACCAAG -3'

Sequencing Primer
(F):5'- AGCAACAATACCTGTCGA -3'
(R):5'- CTCATTGGGTAAAAGCAGTTGCCTC -3'
Posted On2017-06-26