Incidental Mutation 'R5999:Cenpc1'
ID480717
Institutional Source Beutler Lab
Gene Symbol Cenpc1
Ensembl Gene ENSMUSG00000029253
Gene Namecentromere protein C1
Synonyms
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5999 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86012024-86065583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86012263 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 905 (K905N)
Ref Sequence ENSEMBL: ENSMUSP00000031170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031170]
Predicted Effect probably damaging
Transcript: ENSMUST00000031170
AA Change: K905N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031170
Gene: ENSMUSG00000029253
AA Change: K905N

DomainStartEndE-ValueType
Pfam:CENP_C_N 7 121 6.1e-42 PFAM
Pfam:CENP_C_N 115 261 2.6e-46 PFAM
Pfam:CENP-C_mid 265 519 5.4e-100 PFAM
PDB:4INM|W 700 724 5e-9 PDB
Pfam:CENP-C_C 819 903 3.9e-28 PFAM
Meta Mutation Damage Score 0.1658 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a centromeric protein component of a nucleosome-associated complex that plays a central role in kinetochore protein assembly, mitotic progression and chromosome segregation. The human ortholog encodes a protein with DNA-binding activity, that associates constitutively to kinetochores throughout the cell cycle, as part of a prekinetochore complex, together with centromeric protein-A and centromeric protein-B. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Cenpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Cenpc1 APN 5 86037528 missense probably benign 0.02
IGL01287:Cenpc1 APN 5 86022454 nonsense probably null
IGL01363:Cenpc1 APN 5 86046531 nonsense probably null
IGL01720:Cenpc1 APN 5 86045425 missense possibly damaging 0.84
IGL02217:Cenpc1 APN 5 86029200 splice site probably benign
IGL02665:Cenpc1 APN 5 86046403 missense probably benign 0.01
IGL03022:Cenpc1 APN 5 86022375 splice site probably benign
IGL03162:Cenpc1 APN 5 86037905 missense possibly damaging 0.94
IGL03343:Cenpc1 APN 5 86016322 missense probably damaging 0.96
R0130:Cenpc1 UTSW 5 86046546 missense probably benign 0.07
R0193:Cenpc1 UTSW 5 86032403 missense probably benign 0.30
R0314:Cenpc1 UTSW 5 86037371 missense probably benign 0.20
R0932:Cenpc1 UTSW 5 86037600 missense possibly damaging 0.94
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0974:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R1240:Cenpc1 UTSW 5 86035510 missense probably benign 0.32
R1454:Cenpc1 UTSW 5 86013510 missense possibly damaging 0.71
R1677:Cenpc1 UTSW 5 86061998 splice site probably benign
R2044:Cenpc1 UTSW 5 86037755 missense probably benign 0.01
R2256:Cenpc1 UTSW 5 86016203 missense probably damaging 1.00
R3085:Cenpc1 UTSW 5 86037617 missense probably benign 0.01
R4516:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4518:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4561:Cenpc1 UTSW 5 86047632 missense probably damaging 1.00
R4827:Cenpc1 UTSW 5 86034431 missense possibly damaging 0.67
R4864:Cenpc1 UTSW 5 86045321 missense probably damaging 1.00
R5222:Cenpc1 UTSW 5 86037747 missense possibly damaging 0.77
R5707:Cenpc1 UTSW 5 86035434 missense possibly damaging 0.82
R5920:Cenpc1 UTSW 5 86020910 missense probably benign 0.00
R6073:Cenpc1 UTSW 5 86058153 critical splice donor site probably null
R6209:Cenpc1 UTSW 5 86033650 missense probably benign 0.02
R6244:Cenpc1 UTSW 5 86046385 missense probably damaging 1.00
R6278:Cenpc1 UTSW 5 86035535 missense probably damaging 0.97
R6395:Cenpc1 UTSW 5 86035570 missense probably benign 0.14
R7269:Cenpc1 UTSW 5 86013507 missense probably damaging 1.00
R7269:Cenpc1 UTSW 5 86032418 missense probably benign 0.12
R7335:Cenpc1 UTSW 5 86034353 missense possibly damaging 0.95
R7378:Cenpc1 UTSW 5 86046499 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGACAAGATGCCACTTTGTG -3'
(R):5'- AGCTGGCGATGAACTTTGTG -3'

Sequencing Primer
(F):5'- ACTAAACACAGTATTTACACTCAAGG -3'
(R):5'- GTCTTTGGAGTCATGCAGTTAAATC -3'
Posted On2017-06-26