Incidental Mutation 'R5999:Aes'
ID480730
Institutional Source Beutler Lab
Gene Symbol Aes
Ensembl Gene ENSMUSG00000054452
Gene Nameamino-terminal enhancer of split
SynonymsGrg5, Grg, AES
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R5999 (G1)
Quality Score156.008
Status Validated
Chromosome10
Chromosomal Location81559488-81566362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81561264 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 25 (S25P)
Ref Sequence ENSEMBL: ENSMUSP00000002518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002518]
Predicted Effect probably damaging
Transcript: ENSMUST00000002518
AA Change: S25P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002518
Gene: ENSMUSG00000054452
AA Change: S25P

DomainStartEndE-ValueType
Pfam:TLE_N 2 132 1.3e-75 PFAM
low complexity region 156 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220282
Predicted Effect unknown
Transcript: ENSMUST00000220348
AA Change: S16P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220368
Meta Mutation Damage Score 0.7107 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the Aes (amino-terminal enhancer of split) subgroup of the Groucho/transducin-like Enhancer of split (TLE) family of proteins that function as transcriptional corepressors. The encoded protein plays a role in neurological development and cell-fate determination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display altered mating frequency, abnormal pituitary gland growth and development, and varying degrees of postnatal growth retardation leading to premature death among severely runted individuals. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Aes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Aes APN 10 81561292 missense possibly damaging 0.73
IGL02929:Aes APN 10 81564838 splice site probably null
R0092:Aes UTSW 10 81561220 missense possibly damaging 0.69
R2402:Aes UTSW 10 81564878 missense possibly damaging 0.68
R3196:Aes UTSW 10 81565640 missense probably benign
R4091:Aes UTSW 10 81565584 missense probably damaging 1.00
R7854:Aes UTSW 10 81565647 missense probably damaging 0.97
R7937:Aes UTSW 10 81565647 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTCCCAAATGACCAGTGTG -3'
(R):5'- GAACGCTGTATGCCTTACTTTC -3'

Sequencing Primer
(F):5'- TGACCAGTGTGTAAAAGTGTCCCC -3'
(R):5'- AGGATGACCTTGAACTGCTGACC -3'
Posted On2017-06-26