Incidental Mutation 'R6000:Olfr1197'
ID480760
Institutional Source Beutler Lab
Gene Symbol Olfr1197
Ensembl Gene ENSMUSG00000075119
Gene Nameolfactory receptor 1197
SynonymsMOR225-10P, GA_x6K02T2Q125-50202854-50201910, MOR225-14
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6000 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88726903-88732366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88729231 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 123 (A123S)
Ref Sequence ENSEMBL: ENSMUSP00000150290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099815] [ENSMUST00000213118]
Predicted Effect probably damaging
Transcript: ENSMUST00000099815
AA Change: A123S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097403
Gene: ENSMUSG00000075119
AA Change: A123S

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 1.3e-45 PFAM
Pfam:7tm_1 39 285 7.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213118
AA Change: A123S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2051 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Olfr1197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1197 APN 2 88729065 missense probably damaging 1.00
IGL01515:Olfr1197 APN 2 88729008 missense probably benign
IGL01822:Olfr1197 APN 2 88728792 missense probably benign 0.03
IGL02060:Olfr1197 APN 2 88729563 missense probably damaging 0.98
IGL02466:Olfr1197 APN 2 88729395 missense probably damaging 1.00
IGL02698:Olfr1197 APN 2 88729471 missense probably damaging 1.00
R0336:Olfr1197 UTSW 2 88729154 missense possibly damaging 0.47
R1037:Olfr1197 UTSW 2 88729032 missense probably damaging 1.00
R1120:Olfr1197 UTSW 2 88728937 missense probably damaging 1.00
R1674:Olfr1197 UTSW 2 88729257 missense probably damaging 0.99
R1801:Olfr1197 UTSW 2 88729264 missense probably damaging 1.00
R1860:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R1861:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R2049:Olfr1197 UTSW 2 88728745 missense probably damaging 1.00
R2308:Olfr1197 UTSW 2 88729084 missense probably damaging 0.97
R2411:Olfr1197 UTSW 2 88729397 missense probably benign 0.06
R4707:Olfr1197 UTSW 2 88728712 missense possibly damaging 0.62
R5000:Olfr1197 UTSW 2 88729566 missense probably damaging 0.96
R5157:Olfr1197 UTSW 2 88729548 missense probably benign
R6021:Olfr1197 UTSW 2 88728950 nonsense probably null
R6389:Olfr1197 UTSW 2 88728672 missense probably benign 0.00
R6636:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6637:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6979:Olfr1197 UTSW 2 88729184 missense probably benign 0.03
R7618:Olfr1197 UTSW 2 88728836 nonsense probably null
X0020:Olfr1197 UTSW 2 88729381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCAGAGTTGGCAATTG -3'
(R):5'- ATGGACCTCTGCTACACCTC -3'

Sequencing Primer
(F):5'- TTCAGAAGAGGCTTGATGTCACAC -3'
(R):5'- CCACTGTGATTCCCAGGC -3'
Posted On2017-06-26